Document Type : Research Article
Authors
1
Department of Plant Protection, College of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran
2
Department of Plant Pathology, Ferdowsi University of Mashhad, Mashhad, Iran
Abstract
Introduction
Citrus tristeza virus (CTV) is one of the most devastating citrus diseases in Iran. The CTV genome is a positive single-stranded RNA molecule with a size of 19.3 kb containing 12 open reading frames (ORFs). CTV encodes two different coat proteins, of which the small coat protein (CPm) covers only the 3' end of the genome. CTV infected trees show symptoms such as stunting, yellows, reduced vigor and death. In addition, CTV generates three typical disease syndromes, including quick decline, stem pitting and seedling yellows. In total, more than 259 thousand hectares of citrus are grown in the north and south of Iran. Considering the lack of the complete genome sequence of Iranian CTV isolates and the different climatic conditions in citrus cultivation in the north and south of Iran, the genome of CTV isolates from Iran was determined for the first time and their phylogenetic relationships with other CTV isolates were studied.
Materials and Methods
In spring and fall 2015, 30 samples from Mazandaran province in northern Iran and 25 samples from Fars province in southern Iran were collected from trees suspected of being infected with CTVs. Total RNA was extracted using the RNX-Plus kit according to the manufacturer's instructions. CTV was identified using the specific primer pair CPF (5¢AAAGAAGGCGACGATGTTGT3¢) and CPR (5¢AGCTCCGGTCCAAGAAATCTG3¢) designed based on the coat protein gene of CTV. Reverse transcription was performed using MMuLV reverse transcriptase (Pars Tuos, Iran) and PCR reaction was performed using Amplicon 2x PCR Master Mix (Amplicon, Denmark). Infected samples were grafted onto sour orange seedlings. sRNAs were extracted using a protocol developed by Carra et al. (2006), and sRNA libraries were prepared according to the CATS protocol (Turchinovich et al., 2014). One microgram of each library was sequenced on the Illumina HiSeq2500 platform from Macrogen, South Korea. The CTV strains were determined by virtual replication and digestion or alignment of the region between the small coat protein (Cpm) and coat protein (Cp) genes. The phylogenetic tree was constructed by the maximum likelihood method using the T92+I nucleotide substitution model with 500 bootstrap repeats by MEGA7. The nucleotide and amino acid similarity matrix was calculated using SDTv.1.2 software. Potential recombination events in the genome were determined using RDP v.5.5.
Results and Discussion
CTV infection was detected in 17 samples from Mazandaran province (56% of samples) and in 8 samples from Fars province (33% of samples) using a CPF/R-specific primer pair. CTV symptoms were mild to severe stunting, chlorosis, yellowing, vein yellowing, and severe decline in the citrus samples from the north of Iran, while CTV symptoms in the samples from the south of Iran were stunting, chlorosis, dieback and quick decline. Three months post inoculation, symptoms of severe stunting and chlorosis appeared in seedlings inoculated with isolates from the north, while mild stunting and yellowing appeared in seedlings of sour orange inoculated with CTV isolates from the south. By assembling the contigs obtained from the RNA-seq data, the complete genomes of IR-North1, IR-North2, IR-South1, and IR-South2 isolates were reconstructed with lengths of 19296, 19302, 19252, and 19251 nucleotides, respectively. The Iranian CTV isolates had nucleotide similarity in the range of 95.2-77.5% with other CTV isolates deposited in GenBank. The polymerase, P65, and coat protein genes of the Iranian CTV isolates showed identity at the amino acid level of 80.6-94.1%, 88-93.9%, and 92.4-96.4%, respectively, with other CTV isolates. Analysis of the CTV strains revealed that IR-North1 resembles the severe decline strain belonging to genotypic group T36, while IR-South2, IR-North2, and IR-South1 belong to the stem pitting and seedling yellows strains of genotypic group VT/T3 and are similar to strains T3, SY, and T318A, respectively. In the phylogenetic tree based on the full length of the CTV genome, three subclades were designated: VT, T68, and T36. IR-North2, IR-South1, and IR-South2 isolates were grouped into VT, and IR-North1 isolate was grouped into T36. Like the reference CTV isolate, the four Iranian CTV isolates had 12 open reading frames. Examination of the Replicase, RdRp, P65, P61, CPm, and CP proteins revealed 280 amino acid substitutions in 33 conserved motifs in Iranian CTV isolates. The isolate IR-North1 had only five substitutions; however, 97, 85, and 93 substitutions occurred in the isolates IR-North2, IR-South1, and IR-South2, respectively. Most substitutions were found in the replicase and p61 proteins, which are involved in virus replication and assembly, respectively. RdRp and p23 proteins had the least amino acid substitutions. No known conserved motif was observed in P33, P6, P18, P13, and P20 proteins. In addition, IR-North1, IR-North2, and IR-South1 were recombinant. In IR-North1, 1426 nucleotides in the P65 gene and 773 and 2444 nucleotides in the replicase gene were recombinant in IR-North2 and IR-South1 isolates, respectively.
Conclusion
An analysis of symptoms, nucleotide diversity, dominant strains, and the phylogenetic relationship of the four Iranian CTV isolates sequenced in this study revealed that two isolates from northern Iran were quick decline and seedling yellows strains, falling within the genotypic groups T36 and VT. These groups were distinguished by distinct symptoms and a separate phylogenetic position. Conversely, the two southern CTV isolates were closely associated with CTV stem pitting strains, classified into genotypic groups VT and T3, sharing a close phylogenetic position.
Keywords
Subjects