Journal of Iranian Plant Protection Research

Journal of Iranian Plant Protection Research

Distribution and Phylogeny of Grapevine fanleaf virus in Vineyards of Khorasan Razavi Province Based on Coat Protein Region

Document Type : Research Article

Authors
Plant Protection Research Department, Khorasan Razavi Agricultural and Natural Resources Research Education Center, AREEO, Mashhad, Iran
Abstract
Introduction: Virus and virus-like diseases cause intensive damage in vineyards all over the world. Grapevine fanleaf virus (GFLV) is one of the most economic important viruses infecting grapevine worldwide. It is a major limiting factor for grapevine productions and reduces fruit quality and shortens the longevity of grapevines in the vineyards. GFLV belongs to the genus Nepovirus in the family Secoviridae and has a bipartite single-stranded positive RNA genome which encapsidated in isometric particles. Both RNA molecules contain a genome-linked viral protein (VPg) at 5' end and a poly (A) tail at 3' end of genome. GFLV is transmitted naturally from grapevine to grapevine by the ectoparasitic nematode Xiphinema index in the vineyard. Fanleaf disease causes three groups of symptoms, including malformation, vein clearing and yellowing. This difference in symptoms is related to diversity in the genome of the virus because in one cultivar can be seen both groups of symptoms. Khorasan Razavi province has the third largest area under grape cultivation in Iran in this study we studied distribution and diversity of GFLV isolates in vineyards of Khorasan Razavi province.
Materials and Methods

Plant material and virus isolates

During two consecutive growing seasons of 2019 and 2020, a survey was conducted in some of the major areas under the cultivation of grapevine in Khorasan Razavi (Kashmar, Khalilabad, Mohammadiyeh Bardaskan, Neyshabour) at the northeast of Iran. A total of 109 grapevines samples were collected and tested for GFLV infection by enzyme-linked immunosorbent assay (ELISA) as described by Clark and Adams (1977). Total RNA was extracted from petioles of ELISA positive samples using CTAB-PVPP method and were used directly or stored at - 70 0C.

Reverse transcriptase –PCR, cloning and sequencing

cDNA was synthesized by Thermoresistant MMuLV reverse transcriptase (Parstous, Iran) according to the manufacturer's protocol. RT-PCR using specific primer pairs MpF (5'- AGAAGTCGCTCACGATCTGTGAGG -3') and CpR (5'- ACAAACAACACACTGTCGCC- 3') was amplified 1760 bp fragment corresponding to the complete length of coat protein and 230 nucleotides of 3' proximal end in order to detect infected samples. The RT-PCR products were electrophoresed on 1% agarose gel, stained with Green viewer (Pars tous, IRAN), and visualized by UV light.
The gel extracted PCR products were cloned into, pTG19-T PCR Cloning Vector, (Vivantis, Malaysia) following the manufacturer’s instructions and were transformed to Escherichia coli strain DH5α. Then colony-PCR using M13 and the specific primer pairs were used to confirm the recombinant clones. Random recombinant clones were selected to extract plasmid DNA using a Qiagen Plasmid Miniprep Kit (Qiagen, Germany). Finally, The GFLV coat protein gene has been sequenced in both directions.
Results and Discussion: In this study, 109 samples of symptomatic vines were collected from the vineyards of Khorasan Razavi province. 58 samples were confirmed to be infected using indirect ELISA and reverse transcriptase polymerase chain reaction tests. The most symptoms in vineyards were vein banding, leaf malformation, open petiolar sinus, stunting and bushy growth of shoot, zigzagged shoot and double nodes in infected stem. The prevalence of this virus was high in the samples of Mohammadiyeh region. cDAN fragment of GFLV genome with 1760 bp in length corresponding to the GFLV coat protein gene was amplified with specific primers. Full-length sequences of the coat protein gene were recorded in the GenBank. Nucleotide sequence identities of 90-94% were found between the coat protein region of isolates of this study and that of deposited in the GenBank previously. Phylogenetic analysis carried out on the GFLV-CP gene of 5 Iranian GFLV sequences selected in this study showed that GFLV isolates of Iran and the world in the phylogenetic tree were divided into two main groups.
Conclusion: The virus has been detected in northwestern, northeastern and southern vineyards in Iran. Probably GFLV originated in Iran, so widespread spread of the virus in these areas is possible. The propagation of infected cuttings has played a major role in the spread of the virus in vineyards. The capsid protein gene is a conserved region and be used in the molecular phylogenetic analysis and it is the sole viral determinant of the specific transmission of GFLV by its vector. Phylogenetic analysis carried out on the GFLV-CP showed that GFLV isolates were separated into two statistically significant clusters: the first one (I) including isolates from Iran, and the second one (II) including isolates from different countries, and Iranian isolates of GFLV have distinct position in phylogentic tree. Furthermore, evidence of divergent evolution was observed between isolates from northwest, northeast and south of Iran. It confirms that genetic makeup of GFLV may be affected by geographical isolation. The percentage of GFLV infected samples in summer was much lower than the samples detected in mid-spring. The results of previous research also indicated that GFLV titer in the grapevines drops during the summer hot season. High genetic diversity has been observed in coat proteins gene, this change may be due to an error in the RNA-dependent RNA polymerase (RdRp) enzyme during amplification or due to recombination events. Geographical area among them has a positive effect on evolution and phylogenetic relationships.
Keywords
Subjects

  1. Ahmadi K., Ebadzadeh H., Hatami F., Hosseinpour R., and Abdshah H. 2020. Agricultural statistics of horticultural products in 2019. Third volume. Ministry of Jihad Agriculture, Information and Communication Technology Center. 156 pages.
  2. Altschul S.F., Gish W., Miller W., Myers E.W., and Lipman D.J. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403–410.
  3. Andret-Link P., Schmitt-Keichinger C., Demangeat G., Komar , and Fuchs M. 2004. The specific transmission of Grapevine fanleaf virus by its nematode vector Xiphinema index is solely determined by the viral coat protein. Virology 320: 12-22.
  4. Biebricher C., and Eigen M. 2006. What is a quasispecies? In Quasispecies: Concept and Implications for Virology, 1-31 pp.
  5. Clark M.F., and Adams A.N. 1977. Characteristics of the microplate method of the enzyme linked immunosorbent assay for the detection of plant viruses. Journal of General Virology. 34: 474-483.
  6. Dijkstra J., and Jager C.P. 1998. Practical plant virology: protocols and exercises. Springer-Verlag GmbH.
  7. Gholampour Z., Zakiaghl M., Jafarpour B., and Mehrvar M. 2015. Identification and Prevalence of Grapevine fanleaf virus in Khorasan-Razavi Vineyards. Journal of Plant Protection 29(3): 318-324. doi: 10.22067/jpp.v29i3.27668
  8. Gholampour Z., Kargar M., Zakiaghl M., Siampour M., Mehrvar M., and Izadpanah K. 2017. Dynamics of the population structure and genetic variability within Iranian isolates of grapevine fanleaf virus: evidence for polyphyletic origin. Acta Virologica 61(3): 324-335.
  9. Hewitt W.B., Raski D.J., and Goheen A.C. 1958. Nematode vector of soil-borne fanleaf virus of grapevines. Phytopathology 48: 586-595.
  10. Hewitt W.B., Martelli G.P., Dias H.F., and Taylor R.H. 1970. Grapevine fanleaf virus. C. M. I/ A. B. Descriptions of Plant Viruses. No. 28.
  11. Hull 2002. Matthews’ Plant Virology, 4th, Academic Press. London.
  12. Kargar M., Zakiaghl M., Masoumi M., Mehrvar M., and Izadpanah K. 2017. Analysis of genetic diversity of Grapevine fanleaf virus isolate from Fars and Kohgiluyeh-Boyer Ahmad provinces. Iranian Journal of Plant Pathology 52(3): 375-391.
  13. Kumar S., Stecher G., and Tamura K. 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33(7): 1870-1874.
  14. Lu G., and Moriyama E.N. 2004. Vector NTI, a balanced all-in-one sequence analysis suite. Briefings in Bioinformatics 5(4): 378-388.
  15. Martelli G.P., and Savino V. 1990. Fanleaf degeneration. In: Pearson, R.C., Goheen, A. (Eds.), Compendium of Grape Diseases. APS Press, St. Paul, MN, USA, pp. 48–49.
  16. Martelli G.P. 1993. Grapevine degeneration fanleaf. In: Martelli G.P. (ed.). Graft-transmissible diseases of grapevines. Handbook for detection and diagnosis, pp. 9-18. Food and Agriculture Organization of the United Nations, Rome, Italy.
  17. Naraghi-Arani P., Daubert S., and Rowhani A. 2001. Quasispecies nature of the genome of Grapevine fanleaf virus. Journal of General Virology 82(7): 1791-1795.
  18. Nourinejhad Zarghani S., Shams-Bakhsh M., Zand N., Sokhandan-Bashir N., and Pazhouhandeh M. 2012. Genetic analysis of Iranian population of Potato leafroll virus based on ORF0. Virus Genes 45: 567-574.
  19. Nourinezhad Zarghani SH., Shams-Bakhsh M., Sokhandan-Bashir N., and Pazhouhandeh M. 2012. Identification and detection of Iranian isolates of grapevine fanleaf virus using green-grafting and RT-PCR. Iranian Journal of Plant Pathology 48(3): 381-391.
  20. Nourinejhad Zarghani S., Shams‐Bakhsh M., Bashir N.S., and Wetzel T. 2013. Molecular characterization of whole genomic RNA2 from Iranian isolates of Grapevine fanleaf virus. Journal of Phytopathology 161(6): 419-425.
  21. Nourinejhad Zarghani S., Karimi M., Nourinejhad Zarghani A., and Hossein Zadeh M.R. 2015. Genetic diversity of and selection pressure on Grapevine fanleaf virus movement protein in Iranian isolates. Plant Protection 38: 38-49.
  22. Panno S., Caruso AG., Bertacca S., Pisciotta A., Lorenzo RD., Marchione S., Matić S., and Davino S. 2021. Genetic Structure and Molecular Variability of Grapevine Fanleaf Virus in Sicily. Agriculture 11(6): 496. https://doi.org/10.3390/agriculture11060496.
  23. PearsonC., and Goheen A.C. 1988. Compendium of Grape Diseases. APS Press.
  24. Pourrahim R., Farzadfar S., Golnaraghi A.R., and Ahoonmanesh A. 2007. Partial molecular characterization of some Grapevine fanleaf virus isolates from North-east of Iran. Journal of Phytopathology 155: 754-757.
  25. Ritzenthaler , Viry M., Pinck M., Margis R., Fuchs M., and Pinck L. 1991. Complete nucleotide sequence and organization of grapevine fanleaf nepovirus RNA1. Journal of General Virology 72: 2357-2365.
  26. Sanfacon , Wellink J., Le Gall O., Karasev A., van der Vlugt R., and Wetzel T. 2009. Secoviridae: a proposed family of plant viruses within the order Picornavirales that combines the families Sequiviridae and Comoviridae, the unassigned genera Cheravirus and Sadwavirus, and the proposed genus Torradovirus. Archive of Virology 154: 899–907
  27. Schneider W.L., and Roossinck M.J. 2000. Evolutionarily related Sindbis-like plant viruses maintain different levels of population diversity in a common host. Journal of Virology 74(7): 3130-3134.
  28. Serghini M.A., Fuchs M., Pinck M., Reinbolt J., Walter B., and Pinck L. 1990. RNA2 of Grapevine fanleaf virus: sequence analysis and coat protein cistron location. Journal of General Virology 71: 1433-1441.
  29. Sokhandan Bashir N., Hajizadeh M. 2007. Survey for Grapevine fanleaf virus in vineyards of north-west Iran and genetic diversity of isolates. Australasian Plant Pathology 36: 46-52.
  30. Sokhandan Bashir N., Nikkhah Sh., and Hajizadeh M. 2007. Distinct phylogenetic positions of Grapevine fanleaf virus isolates from Iran based on the movement protein gene. Journal of General Plant Pathology 73: 209–215.
  31. Sokhandan Bashir N., Pashaei A., and Doulati-baneh H. 2011. Characterization of the full length coat protein gene of Iranian Grapevine fanleaf virus isolates, genetic variation and phylogenetic analysis. Iranian Journal of Biotechnology 9(3): 213-221.
  32. Sokhandan-Bashir N., and Melcher U. 2012. Population genetic analysis of grapevine fanleaf virus. Archives of Virology 157(10): 1919-1929.
  33. Vigne , Bergdoll M., Guyader S., and Fuchs M. 2004. Population structure and genetic diversity within Grapevine fanleaf virus isolates from a naturally infected vineyard: Evidence for mixed infection and recombination. General Virology 85: 2435-2445.
  34. Vuittenz 1970. Fanleaf of grapevine. In: N. W. Frazier (ed.). Virus disease of small fruits and grapevine. University of California, Berkeley 217-228.
  35. Zaki-Aghl M., and Izadpanah K. 2003. Serological and molecular identification of Grapevine fanleaf virus in Iran. Iranian Journal of Plant Pathology 39: 161-171.
  36. Zhou J., Fan X., Dong Y., ping Zhang Z., Ren F., and Hu G. 2015. Detection and genetic variation analysis of Grapevine fanleaf virus (GFLV) isolates in China. Archives of Virology 160(11): 2661-2667.
Send comment about this article
Enter Name.
Enter a valid email address.
Enter a vaid affiliation.
Enter comments (At leaset 10 words)
CAPTCHA Image
Enter Security Code Correctly.