Journal of Iranian Plant Protection Research

Journal of Iranian Plant Protection Research

Identification and Prevalence of Grapevine fanleaf virus in Khorasan-Razavi Vineyards

Document Type : Research Article

Authors
1 Ferdowsi university of mashhad
2 Ferdowsi University of Mashhad
Abstract
Introduction Grapevine fanleaf virus (GFLV) is one of the devastating viruses of grapevine cause severe crop loss in vineyards. GFLV is a member of the genus Nepovirus in the family Secoviridae. The GFLV genome consists of two positive-sense single-stranded RNAs. The genome has a poly (A) tail at the 3´ terminus and a covalently linked VPg protein at the 5´ terminus. Each genomic RNA encodes a polyprotein from which functional proteins are released by proteolytic processing by the virus-specific protease. GFLV isolates differing in the type of leaf symptoms, ranging from fanleaf, yellow mosaic, vein banding and mottle in different grapevine varieties. GFLV is specifically transmitted from grapevine to grapevine by the ectoparasitic nematode species Xiphinema index. It is also transmitted by grafting, vegetative propagation or mechanical inoculation onto herbaceous plants. GFLV has restricted natural host range, grapevine is the dominant natural host of GFLV and, however, it has been reported on several weeds in Iran. It is thought that the old Persia, especially the region located between the Caspian Sea and the Black Sea, might be the origin of GFLV. Grapevine wide cultures in Khorasan-Razavi province, northeast of Iran, but little information is available for the incidence of GFLV in this region. In the present work, we are interested in the study of the Prevalence of the Grapevine fanleaf virus in Khorasan-Razavi province.
Materials and Methods: To identify the distribution of GFLV in Khorasan-Razavi, 280 leaf samples were randomly collected during the growing season of 2011-2012. GFLV was detected in leaf samples by enzyme-linked immunosorbent assay (ELISA) using specific antibodies raised against Iranian isolate of the virus (Zakiaghl and Izadpanah 2003). Chenopodium quinoa plants were used as systemic herbaceous host for the propagation of GFLV. The carborundum dusted seedlings were inoculated by extracts of ELISA positive samples in phosphate buffer. Total plant RNA were extracted from fresh leaves using silicon dioxide (Boom et al. 1990). The cDNA strand was synthesized using Moloney murine leukemia virus (MMuLV) reverse transcriptase. The partial length of coat protein gene of GFLV isolates was further amplified using DetF (CGGCAGACTGGCAAGCTGT) and DetR (GGTCCAGTTTAATTGCCATCCA) specific primer pair by RT-PCR in leaf samples that were positive in DAS-ELISA. PCR products were run on 1% agarose gel containing 0.5 µg/ml DNA Green Viewer, and visualized under UV irradiation. The PCR products were purified using the Qiaquick PCR purification kit (Qiagen), then were sequenced bidirectionally using DetF/DetRspecific primer pair. Consensus sequences were verified using the BLAST program in NCBI database. Multiple sequence alignments of the nucleotide sequences of the coat protein gene Phylogenetic analysis were carried out by the Neighbour-joining method implemented in MEGA v.5
Results and Discussion: 187 out of 280 samples were found to be infected with GFLV in indirect ELISA. Based on ELISA results, GFLV infection rate in Khorasan-Razavi ranging from 32% to 63%. Kashmar had the most infected vineyards with the prevalence of the virus in 90% of the samples. GFLV induced yellow mosaic and vein banding in infected leaves. Shorten internode, the zigzag growth of stem and double nude were observed in infected grapevines, however, most of the GFLV infected vines were symptomless. Mechanical inoculation with sap extracts from the GFLV positive leaf samples, induced chlorotic local lesions followed by vein clearing in systemic leaves of Chenopodium quinoa two weeks post inoculation. RT-PCR using specific primers amplify 1000 bp fragment corresponding to the GFLV coat protein gene. No fragment was observed in healthy control. Pairwise comparisons of the coat protein gene of four Iranian isolates showed 89%–97% nucleotide sequence identity and 90%–92% identity at the amino acid level with those of previously published GFLV isolates. The phylogenetic tree based on the coat protein gene of the four Iranian isolates and 15 other isolates, with 1000 bootstrap replicates, revealed that all the GFLV isolates were placed in two main clusters, the Iranian isolates being grouped in one distinct cluster and the other GFLV isolates in the other cluster. The Iranian cluster was sub-divided into two sub-clades, which could correspond to two distinct evolutionary lineages reflect their geographical separation.
Conclusion: Grapevine fanleaf virus is the major causal agent of the grapevine degeneration disease. It has been proposed that the origin of GFLV might be the old Persia, especially the region located between the Caspian Sea and the Black Sea. Evidence supporting this theory includes the high levels of divergence and distinct phylogenetic position of Iranian isolates. The sequencing data showed that geographical separation is an important determinant factor in the phylogenetic divergence of GFLV isolates.
Keywords

1- Anonymous. 2012. Statistics reports of ministry of Jahad-Agriculture.
2- Bashir S.N. and Hajizadeh M. 2007. Survey for grapevine fanleaf virus in vineyards of north-west Iran and genetic diversity of isolates, Australasian Plant Pathology, 36: 46-52.
3- Bashir S.N., Pashaei A. and Doulati-baneh H. 2011. Characterization of the full length coat protein gene of Iranian Grapevine fanleaf virus isolates, genetic variation and phylogenetic analysis, Iranian Journal of Biotechnology, 9:213-221.
4- Boom R., Sol C.J.A., Salimans M.M.M., Jansen C.L., Wertheim-van Dillen P.M., Van der Noorda J. 1990. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology, 28:495-503.
5- Esmenjaud D. and Adab P. 1994. Detection of a region of the coat protein gene of Grapevine fanleaf virus by RT-PCR in the nematode vector Xiphinema index, Plant Disease, 78: 1087-1090.
6- Fattouch S., Acheche H., Mhirsi S., Mellouli L., Bejar S., Marrakchi M. and Marzouki N. 2005. RT-PCR–RFLP for genetic diversity analysis of Tunisian Grapevine fanleaf virus isolates in their natural host plants, Journal of Virological Methods 127:126–132.
7- Gambino G., Perrone I. and Gribaudo I. 2008. A rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants, Phytochemical Analaysis 19: 520–525.
8- Hajizadeh M., Sokhandan-bashir N., Niknam A. and Nikkhah Sh. 2007. Optimization of Nucleic Acid Extraction and RT-PCR for Detection of Grapevine fanleaf virus Isolates from Vineyards in North-West of Iran. Journal of Agricultural Science, 16:145-156.
9- Hampton R., Ball E. and De Boer S. 1990. Serological methods for detection and identification of viral and bacterial plant pathogens. Aps PRESS, 388 pages. Convert. R. and Martin, R., Indirect ELISA. Pp: 179-197.
10- Hewitt W.B., Raski D.J. and Goheen A.C. 1958. Nematode vector of soil-borne fanleaf virus of grapevines. Phytopathology, 48:586-595.
11- Hewitt W.B., Martelli G.P., Dias H.F. and Taylor R.H. 1970. Grapevine fanleaf virus. C. M. I/ A.A. B. Descriptions of Plant Viruses. No. 28.
12- Hinkle R.P. 1995. Fanleaf, the unmentionable virus. Wines and vines, 76:24-27.
13- Izadpanah K., Zaki-Aghl M., Zhang Y.P., Daubert S.D., and Rowhani A. 2003. Bermuda grass as a potential reservoir host for grapevine fanleaf virus, Plant Disease, 87: 1179-1182.
14- MacKenzie D.J., Mclean M.A., Mukerji S. and Green M. 1997. Improved RNA extraction from woody plants for the detection of viral pathogens by reverse transcription-polymerase chain reaction, Plant Disease, 81: 222-226.
15- Martelli G.P. 1993. Graft-transmissible disease of grapevines. Handbook for detection and diagnosis. (Ed) G. P. Martelli, (p. 263) FAO. Roma.
16- Naraghi-Arani P., Daubert S. and Rowhani A. 2001. Quasispecies nature of the genome of Grapevine fanleaf virus, Journal of General Virology, 82, 1791–1795.
17- Noorinejad Zarqani Sh., Shamsbakhsh M., Sokhandan bashir N. and Pajoohandeh, M. 2012. Identification and detection of Iranian osplates of Grapevine fanleaf virus using green-gfafting and RT-PCR. Plant Pathology, 48: 381-391.
18- Parvizi R. 1989. Occurrence of grapevine fanleaf disease in vineyards of Ourmia. In: Proceedings of the 9th Plant Protection Congress of Iran, 9-14 Sep., Mashhad, Iran. p. 164.
19- Ritzenthler C., Viry M., Pinck M., Margis R., Fuchs M. and Fucks L. 1991. Complete nucleotide sequence and genetic organization of Grapevine fanleaf nepovirus, Journal of General Virology, 72: 2357-2365.
20- Rowhani A., Chay C., Golino D.A. and Falk W. 1993. Development of a Polymerase chain reaction technique for the detection of grapevine fanleaf virus in grapevine tissue, Phytopathology, 83:749-753.
21- Salami A.R., Ebadi A., Kuhi-habibi M. and Zamani Z. 2011. Study of Grapevine fanleaf virus Distribution in Iran Using Test Plants, DAS-ELISA and IC-RT-PCR, Iranian Journal of Plant Protection Science, 42:11-18.
22- Vuittenz A. 1970. Fanleaf of grapevine. In: N. W. Frazier (ed.). Virus disease of small fruits and grapevine. University of California, Berkeley, pp. 217-228.
23- Vigne E., Bergdoll M., Guyader S. and Fuchs M. 2004. Population structure and genetic diversity within Grapevine fanleaf virus isolates from a naturally infected vineyard: Evidence for mixed infection and recombination, Journal of general virology, 85: 2435-2445.
24- Ward C.W. 1993. Progress towards a higher taxonomy of viruses, Research in Virology, 114:419-453.
25- Zaki-Aghl M. and Izadpanah K. 2003. Serological and molecular identification of grapevine fanleaf virus in Iran, Iranian Journal of Plant Pathology, 39, 161-171.
Send comment about this article
Enter Name.
Enter a valid email address.
Enter a vaid affiliation.
Enter comments (At leaset 10 words)
CAPTCHA Image
Enter Security Code Correctly.