مقایسه علایم، تعیین توالی کامل و تحلیل فیلوژنتیکی جدایه‌های ویروس تریستزای مرکبات از استان‌های مازندران و فارس

نوع مقاله : مقالات پژوهشی

نویسندگان

1 گروه گیاهپزشکی، دانشکده کشاورزی، دانشگاه فردوسی مشهد، مشهد، ایران

2 گروه گیاه‌پزشکی، دانشکده کشاورزی، دانشگاه فردوسی مشهد، مشهد، ایران

چکیده

ویروس تریستزای مرکبات (Citrus tristeza virus-CTV) یکی از بیماری­های مهم درختان مرکبات در اغلب مرکبات کاری‌های ایران است. در این تحقیق توالی کامل ویروس تریستزای مرکبات از دو منطقه مرکبات خیز استان مازندران و استان فارس تعیین و برخی صفات بیولوژیکی و مولکولی آن­ها با یکدیگر مقایسه شده است. 56 درصد از نمونه­های جمع‌آوری شده از استان مازندران و 32 درصد نمونه‌های تهیه شده از استان فارس در آزمون زنجیره­ای پلی­مراز آلوده به ویروس تریستزای مرکبات بودند. علایم CTV در نمونه‌های مرکبات استان مازندران کوتولگی خفیف تا شدید، سرخشکیدگی، زردی، زردی رگبرگ و زوال سریع بود در حالی­که در نمونه‌های استان فارس علایم CTV، کوتولگی، سبزخشکیدگی، زردی، و سرخشکیدگی شاخه‌ها بود. سه ماه پس از مایه­زنی نیز علائم کوتولگی شدید، رگبرگ روشنی، زردی و ریزبرگی در نهال‌های مایه‌زنی شده با جدایه‌های استان مازندران و علایم کوتولگی خفیف، رگبرگ روشنی، زردی و ریزبرگی در نهال­های نارنج بذری مایه‌زنی شده با جدایه‌های استان فارس ایجاد شد. از درختان مرکبات آلوده به تریستزا از استان‌های فارس و مازندران نمونه­برداری و از آنها کتابخانه sRNA تهیه و توالی­یابی شدند. نتایج نشان داد که طول ژنوم کامل بازسازی شده برای جدایه­های IR-North1، IR-North2، IR-South1 و IR-South2 به‌ترتیب 19296، 19302، 19252 و 19251 نوکلئوتید است و در سطح نوکلئوتیدی با سایر جدایه­های CTV موجود در بانک ژن بین 5/77-2/95 درصد شباهت داشتند. بررسی توالی پروتئین­ها نشان‌دهنده وجود 280 جایگزینی در 33 موتیف در جدایه‌های توالی­یابی شده CTV بود. کمترین تغییرات در جدایه IR-North1 با پنج جایگزینی بود. در جدایه­های IR-North2، IR-South1 و IR-South2 به‌ترتیب 97، 85 و 93 جایگزینی اتفاق افتاده بود. بیشترین جایگزینی در چارچوب‌های ژنی ORF1a و p61 بود. تعیین سویه جدایه­ها با همانندسازی و هضم مجازی و همردیف‌سازی ناحیه بین ژن­های پوشش پروتئینی کوچک (Cpm) و پوشش پروتئینی نشان داد که جدایه IR-North1 مشابه نژاد‌های مولد زوال سریع و سویه T36 و جدایه­های IR-South2، IR-North2 و IR-South1 از نژاد‌های مولد ساقه آبله‌ای و زردی نهالچه و به‌ترتیب مشابه با سویه T3، SY و T318A هستند. در درخت فیلوژنی ترسیم شده بر اساس طول کامل ژنوم نیز سه جدایه IR-North2 و IR-South1 و IR-South2، در گروه VT و جدایه IR-North 1 در گروه T36 قرار گرفتند. همچنین بررسی وقوع نوترکیبی احتمالی در جدایه‌های ایرانی نشان داد که جدایه‌های IR-North1، IR-North2 و IR-South1 در ژن­های رپلیکاز و P65 نوترکیب هستند. نتایج بررسی علائم و توالی کامل چهار جدایه بدست آمده نشان داد که دو جدایه بدست آمده از استان مازندران از لحاظ نوع علائم و جایگاه فیلوژنی از هم متفاوت هستند ولی دو جدایه استان فارس از نظر فیلوژنی و ژنوتیپی با یکدیگر قرابت دارند.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Comparison of Symptoms, Whole Genome Sequencing, and Phylogenetic Analysis of Isolates of Citrus tristeza virus from Mazandaran and Fars Provinces in Iran

نویسندگان [English]

  • N. Rouhani 1
  • M. Zakiaghl 2
  • M. Mehrvar 2
1 Department of Plant Protection, College of Agriculture, Ferdowsi University of Mashhad, Mashhad, Iran
2 Department of Plant Pathology, Ferdowsi University of Mashhad, Mashhad, Iran
چکیده [English]

Introduction
Citrus tristeza virus (CTV) is one of the most devastating citrus diseases in Iran. The CTV genome is a positive single-stranded RNA molecule with a size of 19.3 kb containing 12 open reading frames (ORFs). CTV encodes two different coat proteins, of which the small coat protein (CPm) covers only the 3' end of the genome. CTV infected trees show symptoms such as stunting, yellows, reduced vigor and death. In addition, CTV generates three typical disease syndromes, including quick decline, stem pitting and seedling yellows. In total, more than 259 thousand hectares of citrus are grown in the north and south of Iran. Considering the lack of the complete genome sequence of Iranian CTV isolates and the different climatic conditions in citrus cultivation in the north and south of Iran, the genome of CTV isolates from Iran was determined for the first time and their phylogenetic relationships with other CTV isolates were studied.
 
Materials and Methods
In spring and fall 2015, 30 samples from Mazandaran province in northern Iran and 25 samples from Fars province in southern Iran were collected from trees suspected of being infected with CTVs. Total RNA was extracted using the RNX-Plus kit according to the manufacturer's instructions. CTV was identified using the specific primer pair CPF (5¢AAAGAAGGCGACGATGTTGT3¢) and CPR (5¢AGCTCCGGTCCAAGAAATCTG3¢) designed based on the coat protein gene of CTV. Reverse transcription was performed using MMuLV reverse transcriptase (Pars Tuos, Iran) and PCR reaction was performed using Amplicon 2x PCR Master Mix (Amplicon, Denmark). Infected samples were grafted onto sour orange seedlings. sRNAs were extracted using a protocol developed by Carra et al. (2006), and sRNA libraries were prepared according to the CATS protocol (Turchinovich et al., 2014). One microgram of each library was sequenced on the Illumina HiSeq2500 platform from Macrogen, South Korea. The CTV strains were determined by virtual replication and digestion or alignment of the region between the small coat protein (Cpm) and coat protein (Cp) genes. The phylogenetic tree was constructed by the maximum likelihood method using the T92+I nucleotide substitution model with 500 bootstrap repeats by MEGA7. The nucleotide and amino acid similarity matrix was calculated using SDTv.1.2 software. Potential recombination events in the genome were determined using RDP v.5.5.
 
 
Results and Discussion
CTV infection was detected in 17 samples from Mazandaran province (56% of samples) and in 8 samples from Fars province (33% of samples) using a CPF/R-specific primer pair. CTV symptoms were mild to severe stunting, chlorosis, yellowing, vein yellowing, and severe decline in the citrus samples from the north of Iran, while CTV symptoms in the samples from the south of Iran were stunting, chlorosis, dieback and quick decline. Three months post inoculation, symptoms of severe stunting and chlorosis appeared in seedlings inoculated with isolates from the north, while mild stunting and yellowing appeared in seedlings of sour orange inoculated with CTV isolates from the south. By assembling the contigs obtained from the RNA-seq data, the complete genomes of IR-North1, IR-North2, IR-South1, and IR-South2 isolates were reconstructed with lengths of 19296, 19302, 19252, and 19251 nucleotides, respectively. The Iranian CTV isolates had nucleotide similarity in the range of 95.2-77.5% with other CTV isolates deposited in GenBank. The polymerase, P65, and coat protein genes of the Iranian CTV isolates showed identity at the amino acid level of 80.6-94.1%, 88-93.9%, and 92.4-96.4%, respectively, with other CTV isolates. Analysis of the CTV strains revealed that IR-North1 resembles the severe decline strain belonging to genotypic group T36, while IR-South2, IR-North2, and IR-South1 belong to the stem pitting and seedling yellows strains of genotypic group VT/T3 and are similar to strains T3, SY, and T318A, respectively. In the phylogenetic tree based on the full length of the CTV genome, three subclades were designated: VT, T68, and T36. IR-North2, IR-South1, and IR-South2 isolates were grouped into VT, and IR-North1 isolate was grouped into T36. Like the reference CTV isolate, the four Iranian CTV isolates had 12 open reading frames. Examination of the Replicase, RdRp, P65, P61, CPm, and CP proteins revealed 280 amino acid substitutions in 33 conserved motifs in Iranian CTV isolates. The isolate IR-North1 had only five substitutions; however, 97, 85, and 93 substitutions occurred in the isolates IR-North2, IR-South1, and IR-South2, respectively. Most substitutions were found in the replicase and p61 proteins, which are involved in virus replication and assembly, respectively. RdRp and p23 proteins had the least amino acid substitutions. No known conserved motif was observed in P33, P6, P18, P13, and P20 proteins. In addition, IR-North1, IR-North2, and IR-South1 were recombinant. In IR-North1, 1426 nucleotides in the P65 gene and 773 and 2444 nucleotides in the replicase gene were recombinant in IR-North2 and IR-South1 isolates, respectively.
 
Conclusion
An analysis of symptoms, nucleotide diversity, dominant strains, and the phylogenetic relationship of the four Iranian CTV isolates sequenced in this study revealed that two isolates from northern Iran were quick decline and seedling yellows strains, falling within the genotypic groups T36 and VT. These groups were distinguished by distinct symptoms and a separate phylogenetic position. Conversely, the two southern CTV isolates were closely associated with CTV stem pitting strains, classified into genotypic groups VT and T3, sharing a close phylogenetic position.

کلیدواژه‌ها [English]

  • Citrus
  • Quick decline
  • NGS
  • Race
  • Seedling yellows
  • Stem pitting
  1. Ahmadi, S., Afsharifar, A., Niazi, A., Sadeghi, M., & Izadpanah, K. )2006(. Distribution and analysis of genetic diversity of Citrus tristeza virus (CTV) isolates in Kerman Province. 17th Iranian Plant Protection Congress, 289.(In Persian with English abstract)
  2. Alavi, A., Khatabi, B., & Salekdeh, G.H. (2005). Comparison of biologically distinct isolates of Citrus tristeza virus from Iran using major coat protein seq uences. Australian Plant Pathology, 34(4), 577-582. https://doi.org/10.1071/AP05079
  3. Albiach-Martı́, M.R., Guerri, J., Cambra, M., Garnsey, S.M., & Moreno, P. (2000). Differentiation of Citrus tristeza virus isolates by serological analysis of p25 coat protein peptide maps. Journal of Virological Methods88(1), 25-34. https://doi.org/10.1016/s0166-0934(00)00165-8
  4. Albiach-Marti, M.R., Mawassi, M., Gowda, S., Satyanarayana, T., Hilf, M.E., Shanker, S., Almira, E.C., Vives, M.C., Lopez, C., Guerri, J., Flores, R., Moreno, P., Garnsey, S.M., & Dawson, W.O. (2000b). Sequences of Citrus tristeza virus separated in time and space are essentially identical. Journal of Virology, 74, 6856-6865. https://doi.org/1128/jvi.74.15.6856-6865.2000
  5. Barzegar, A., Rahimian, H., & Hashemi Sohi, H. (2010). Comparison of the minor coat protein gene sequences of aphid-transmissible and-nontransmissible isolates of Citrus tristeza virusJournal of General Plant Pathology76, 143-151. https://doi.org/1007/s10327-009-0216-7
  6. Barzegar, A., Sohi, H.H., & Rahimian, H. (2006). Characterization of Citrus tristeza virus isolates in northern Iran. Journal of General Plant Pathology,72, 46-51. https://doi.org/1007/s10327-005-0249-5
  7. Bester, R., Cook, G., & Maree, H.J. (2021). Citrus tristeza virus genotype detection using high-throughput sequencing. Viruses,13, 2-168. https://doi.org/10.3390/v13020168
  8. Biswas, K.K., Tarafdar, A., & Sharma, S.K. (2012). Complete genome sequence of mandarin decline Citrus tristeza virus of the northeastern Himalayan hill region of India: comparative analyses determine recombinant. Archives of Virology, 157, 579–583. https://doi.org/10.1007/s00705-011-1165-y
  9. Carra, A.M., Gambino, G., & Schubert, A. (2007) A cetyltrimethylammonium bromide-based method to extract low-molecular-weight RNA from polysaccharide-rich plant tissues. Biochemistry, 360, 318. https://doi.org/10.1016/j.ab.2006.09.022
  10. Cheng, X.F., Wu, X.Y., Wang, H.Z., Sun, Y.Q., Qian, Y.S., & Luo, L. (2012). High codon adaptation in Citrus tristeza virus to its citrus host. Virology Journal, 9, 113. https://doi.org/1186/1743-422X-9-113
  11. Coetzee, B., Freeborough, M.J., Maree, H.J., Celton, J.M., Rees, D.J.G., & Burger, J.T. (2010). Deep sequencing analysis of viruses infecting grapevines: virome of a vineyard. Virology400(2), 157-163. https://doi.org/11016/j.virol.2010.01.023
  12. Cook, G., van Vuuren, S.P., Breytenbach, J.H., Steyn, C., Burger, J.T., & Maree, H.J. (2016). Characterization of Citrus tristeza virus single-variant sources in grapefruit in greenhouse and field trials. Plant Disease, 100(11), 2251-2256. https://doi.org/1094/PDIS-03-16-0391-RE
  13. Cowell, S.J., Harper, S.J., & Dawson, W.O. (2016). Some like it hot: Citrus tristeza virus strains react differently to elevated temperature. Archives of Virology161, 3567-3570. https://doi.org/1007/s00705-016-3083-5
  14. Dawson, W.O., Bar-Joseph, M., Garnsey, S.M., & Moreno, P. (2015). Citrus tristeza virus: making an ally from an enemy. Annual Review of Phytopathology,5, 137-155. https://doi.org/1146/annurev-phyto-080614-120012
  15. Ebrahim-Nesbat, F., & Nienhaus, F. (1978). Occurrence of Citrus tristeza virus in Iran/Auftreten von Citrus-Tristeza virus in Iran. Zeitschrift für Pflanzenkrankheiten und Pflanzenschutz/Journal of Plant Diseases and Protection, 308-312.
  16. Flores, R., Ruiz-Ruiz, S., Soler, N., Sánchez-Navarro, J., Fagoaga, C., López, C., Navarro, L., Moreno, P., & Peña, L. (2013). Citrus tristeza virus p23: a unique protein mediating key virus–host interactions. Frontiers in Microbiology,4, 98. https://doi.org/3389/fmicb.2013.00098
  17. Gottwald, T.R., Garnsey, S.M., & Borbón, J. (1998). Increase and patterns of spread of Citrus tristeza virus infections in Costa Rica and the Dominican Republic in the presence of the brown citrus aphid, Toxoptera citricida. Phytopathology, 88, 621-636. https://doi.org/11094/PHYTO.1998.88.7.621
  18. Gushchin, V.A., Karlin, D.G., Makhotenko, A.V., Khromov, A.V., Erokhina, T.N., Solovyev, A.G., Morozov, S.Y., & Agranovsky, A.A. (2017). A conserved region in the Closterovirus 1a polyprotein drives extensive remodeling of endoplasmic reticulum membranes and induces motile globules in Nicotiana benthamianaVirology502, 106-113. https://doi.org/10.1016/j.virol.2016.12.006
  19. Harper, S.J., Dawson, T.E., & Pearson, M.N. (2009). Complete genome sequences of two distinct and diverse Citrus tristeza virus isolates from New Zealand. Archives of Virolology, 154, 1505–1510.
  20. Harper, S.J., & Pearson, M.N. (2015). Citrus tristeza virus strains present in New Zealand and the South Pacific. Journal of Citrus Pathology2, 1. https://doi.org/1007/s00705-009-0456-z
  21. Harper, S.J. (2013). Citrus tristeza virus: evolution of complex and varied genotypic groups. Frontiers in Microbiology4, 93. https://doi.org/10.3389/fmicb.2013.00093
  22. Herrera-Isidrón, L., Ochoa-Sánchez, J.C., Rivera-Bustamante, R., & Martinez- Soríano, J.P. (2009). Sequence diversity on four ORFs of Citrus tristeza virus correlates with pathogenicity. Virology Journal, 6, 116. https://doi.org/10.1186/1743-422X-6-116
  23. Huang, Y.W., Hu, C.C., Liou, M.R., Chang, B.Y., Tsai, C.H., & Meng, M. (2012). Hsp90 interacts specifically with viral RNA and differentially regulates replication initiation of Bamboo mosaic virus and associated satellite RNA. PLoS Pathology, 8, e1002726. https://doi.org/10.1371/journal.ppat.1002726
  24. Iftikhar, Y., Abbas, M., Mubeen, M., Zafar-ul-Hye, M., Bakhtawar, F., Bashir, S., Sajid, A., & Shabbir, M.A., (2021). Overview of strain characterization in relation to serological and molecular detection of Citrus tristeza ClosterovirusPhyton90(4), 1063. https://doi.org/10.32604/phyton.2021.015508
  25. Iki, T., Yoshikawa, M., Nishikiori, M., Jaudal, M.C., Matsumoto Yokoyama, E., & Mitsuhara, I. (2010). In vitro assembly of plant RNA-induced silencing complexes facilitated by molecular chaperone HSP90. Moecular Cell, 39, 282–291. https://doi.org/1016/j.molcel.2010.05.014
  26. Jo, Y., Choi, H., Kim, S.M., Kim, S.L., Lee, B.C., & Cho, W.K. (2017). The pepper virome: natural co-infection of diverse viruses and their quasispecies. BMC Genomics,1, 1-12. https://doi.org/1186/s12864-017-3838-8
  27. Jo, Y., Choi, H., Kim, S.M., Kim, S.L., Lee, B.C., & Cho, W.K. (2016). Integrated analyses using RNA-Seq data reveal viral genomes, single nucleotide variations, the phylogenetic relationship, and recombination for Apple stem grooving virus. BMC Genomics,17, 1,1-12. https://doi.org/1186/s12864-016-2994-6
  28. Kashif, M., Pietilä, S., Artola, K., Jones, R.A.C., Tugume, A.K., Mäkinen, V., & Valkonen, J.P.T. (2012). Detection of viruses in sweetpotato from Honduras and Guatemala augmented by deep-sequencing of small-RNAs. Plant Disease96(10), 1430-1437. https://doi.org/1094/PDIS-03-12-0268-RE
  29. Lbida, B., Bennani, A., Serrhini, M.N., & Zemzami, M. (2005). Biological, serological and molecular characterization of three isolates of Citrus tristeza closterovirus introduced into Morocco. EPPO Bulletin35(3), 511-517. https://doi.org/1111/j.1365-2338.2005.00895.x
  30. Li, R., Gao, S., Hernandez, A.G., Wechter, W.P., Fei, Z., & Ling, K.S. (2012). Deep sequencing of small RNAs in tomato for virus and viroid identification and strain differentiation. PloS One7, e37127. https://doi.org/10.1371/journal.pone.0037127
  31. Matsumura, E.E., Coletta-Filho, H.D., Nouri, S., Falk, B.W., Nerva, L., Oliveira, T.S., Dorta, S.O., & Machado, M.A. (2017). Deep sequencing analysis of RNAs from citrus plants grown in a citrus sudden death-affected area reveals diverse known and putative novel viruses. Viruses, 9(4), 92. https://doi.org/3390/v9040092.
  32. Melzer, M.J., Borth, W.B., Sether, D.M., Ferreira, S., Gonsalves, D., & Hu, J.S. (2010). Genetic diversity and evidence for recent modular recombination in Hawaiian Citrus tristeza virusVirus Genes, 40, 111-118. https://doi.org/11007/s11262-009-0409-3
  33. Mine, A., & Okuno, T. (2012). Composition of plant virus RNA replicase complexes. Current Opinion Virology,2, 669–675. https://doi.org/1016/j.coviro.2012.09.014
  34. Moreno, P., Ambros, S., Albiach-Marti, M.R., Guerri, J., & Peoa, L. (2008). Citrus tristeza virus: a pathogen that changed the course of the citrus industry Molecular Plant Patholology, 9, 251-268. https://doi.org/1111/j.1364-3703.2007.00455.x
  35. Moshe, B.J., & Munir, M. (2000). The Role of Defective RNAs in Citrus Tristeza Virus https://doi.org/10.3389/fmicb.2013.00132
  36. O’Neal, S.T., Samuel, G.H., Adelman, Z.N., & Myles, K.M. (2014). Mosquito-borne viruses and suppressors of invertebrate antiviral RNA silencing. Viruses6(11), 4314-4331.  https://doi.org/3390/v6114314
  37. Pais da Cunha, A.T., Chiumenti, M., Ladeira, L.C., Abou Kubaa, R., Loconsole, G., Pantaleo, V., & Minafra, A. (2021). High throughput sequencing from Angolan citrus accessions discloses the presence of emerging CTV strains. Virology Journal18(1), 1-8. https://doi.org/1186/s12985-021-01535-x
  38. Pappu, H.R., Pappu, S.S., Kano, T., Koizumi, M., Cambra, M., Moreno, P., & Niblett, C.L. (1995). Mutagenic Analysis and Localization of a Highly Conserved Epitope. Phytopathology85, 1311-1315. https://doi.org/1094/Phyto-85-1311
  39. Ramírez-Pool, J.A., Xoconostle-Cázares, B., Calderón-Pérez, B., Ibarra-Laclette, E., Villafán, E., Lira-Carmona, R., & Ruiz-Medrano, R. (2022). Transcriptomic analysis of the host response to mild and severe CTV strains in naturally infected Citrus sinensis orchards. International Journal of Molecular Sciences23(5), 2435. https://doi.org/3390/ijms23052435.
  40. Roy, A., & Brlansky, R.H. (2010). Genome analysis of an orange stem pitting Citrus tristeza virus isolate reveals a novel recombinant genotype. Virus Research, 151, 118–130. https://doi.org/1016/j.virusres.2010.03.017
  41. Ruiz-Ruiz, S., Moreno, P., Guerri, J., & Ambrs S. (2006). The complete nucleotide sequence of a severe stem pitting isolate of Citrus tristeza virus from Spain: comparison with isolates from different origins. Archives of Virology, 151, 387–398. https://doi.org/1007/s00705-005-0618-6
  42. Ruiz-Ruiz, S., Navarro, B., Gisel, A., Pena, L., Navarro, L., Moreno, P., Serio, F.D., & Flores, R. (2011). Citrus tristeza virus infection induces the accumulation of viral small RNAs (21–24-nt) mapping preferentially at the 3′-terminal region of the genomic RNA and affects the host small RNA profile. Plant Molecular Biology75, 607-619. https://doi.org/1007/s11103-011-9754-4
  43. Saponari, M., & Yokomi, R.K. (2010). Use of the coat protein (CP) and minor CP intergene sequence to discriminate severe strains of Citrus tristeza virus (CTV) in three US CTV isolate collections. In International Organization of Citrus Virologists Conference Proceedings (1957-2010), 17, 17.
  44. Satyanayanana, T., Gowda, S., Ayllón, M.A., & Dawson, W. O. (2004). Closterovirus bipolar virion: evidence for initiation of assembly by minor coat protein and its restriction to the genomic RNA 5´region. Proceeding of National Academic Science. USA, 101, 799-804. https://doi.org/10.1073/pnas.0307747100
  45. Suastika, C., Natsuaki, T., Terui, H., Kano, T., Ieki, H., & Okuda, S. (2001). Nucleotide sequence of Citrus tristeza virus seedling yellows isolate. Journal of General Plant Pathology, 67(1), 73-77. https://doi.org/1007/PL00012992
  46. Turchinovich, A., Surowy, H., Serva, A., Zapatka, M., Lichter, P., & Burwinkel, B. (2014). Capture and Amplification by Tailing and Switching (CATS) An ultrasensitive ligation-independent method for generation of DNA libraries for deep sequencing from picogram amounts of DNA and RNA. RNA biology11(7), 817-828. https://doi.org/4161/rna.29304
  47. Vives, M.C., Rubio, L., Lopez, C., Navas-Castillo, J., Albiach-Martí, M.R., Dawson, W.O., Guerri, J., Flores, R., Moreno, P. (1999). The complete genome sequence of the major component of a mild citrus tristeza isolate. Journal of General Virology, 80, 811–816. https://doi.org/1099/0022-1317-80-3-811
  48. Wang, X., Goregaoker, S. P., & Culver, J. N. (2009). Interaction of the Tobacco mosaic virus replicase protein with a NAC domain transcription factoris associated with the suppression of systemic host defenses.  Journal of Virology. 83, 9720–9730. https://doi.org/1128/JVI.00941-09
  49. Weng, Z., Barthelson, R., Gowda, S., Hilf, M. E., Dawson, W. O., Galbraith, D. W., & Xiong, Z. (2007). Persistent infection and promiscuous recombination of multiple genotypes of an RNA virus within a single host generate extensive diversity. PLoS One, 2(9), e917. https://doi.org/1371/journal.pone.0000917
  50. Wylie, S. J., Li, H., Saqib, M., & Jones, M. G. (2014). The global trade in fresh produce and the vagility of plant viruses: a case study in garlic. PLoS One, 9 (8), e105044. https://doi.org/1371/journal.pone.0105044
  51. Wu, G.W., Tang, M., Wang, G.P., Wang, C.X., Liu, Y., Yang, F., & Hong, N. (2014). The epitope structure of Citrus tristeza virus coat protein mapped by recombinant proteins and monoclonal antibodies. Virology448, 238-246. https://doi.org/1016/j.virol.2013.10.021
  52. Yokomi, R., Selvaraj, V., Maheshwari, Y., Chiumenti, M., Saponari, M., Giampetruzzi, A., Weng, Z., Xiong, Z., & Hajeri, S. (2018). Molecular and biological characterization of a novel mild strain of Citrus tristeza virus in California. Archives of Virology163, 1795-1804. https://doi.org/1007/s00705-018-3799-5
  53. Yokomi, R. (2019). CTV vectors and interactions with the virus and host plants. Citrus Tristeza Virus: Methods and Protocols, 29-53. https://doi.org/1007/978-1-4939-9558-5_4.

 

 

 

CAPTCHA Image