دانشگاه فردوسی مشهدپژوهش های حفاظت گیاهان ایران2980-817035420220121Evaluation of Effect of Different Fungicides on Fungus Podosphaera leucotricha, the Causal Agent of Apple Powdery Mildew Diseaseارزیابی اثرات قارچکشهای مختلف روی قارچ Podosphaera leucotricha ، عامل بیماری سفیدک پودری سیب درختی3994074074210.22067/jpp.2021.32823.0FAحسین کربلائی خیاویمرکز تحقیقات و آموزش کشاورزی و منابع طبیعی استان اردبیل (مغان)، سازمان تحقیقات، آموزش و ترویج کشاورزی، اردبیل، ایرانحسین خباز جلفاییمؤسسه تحقیقات گیاهپزشکی کشور، سازمان تحقیقات، آموزش و ترویج کشاورزی، تهران، ایرانحسین رمضانیمرکز تحقیقات و آموزش کشاورزی و منابع طبیعی استان اردبیل (مغان)، سازمان تحقیقات، آموزش و ترویج کشاورزی، اردبیل، ایرانJournal Article20200923<strong>Introduction:</strong> Apple (<em>Malus domestica</em>, Borkh) is considered one of the most common popular and favorite deciduous fruit trees cultivated in Iran. Various harmful factors affect the performance of this fruit. Apple powdery mildew disease is one of the most important apple diseases that has a worldwide distribution and causes disease and is caused by the fungus <em>Podosphaera leucotricha </em>Ell. Et Ev. This fungus is an obligate parasite and it can attack to leaves, flowers, fruits and twigs. In the beginning of spring the disease appeared on leaves which are the most susceptible organs. The disease appears on the upperside of infected leaf as powdery white lesions and eventually the infected part of leaf turn brown and infections on the underside of infected leaf result in chlorotic patches. Infected leaves become crinkle, curl and drop prematurely. Although blossom and fruit infections are less common, they are important because infected fruits are small and stunted if they do not drop. <em>P. leucotricha</em> survives the winter as mycelium in vegetative tissues or in infected flower buds. The primary infection starts when infected buds break dormancy and fungus resumes growth and colonizes developing shoots. Spores growing on infected shoots spread nearby and initiate secondary infections. Also it causes early loss of leaves and stop the growth of diseased branches and as a result, the loss of yield. In heavily infected trees, rust can be seen on fruit surface. Powdery mildew infection usually occurs at relative humidity above 70%, and on days when humidity is low, the infection usually occurs at night or in the early morning hours when the humidity is high. Although the use of effective fungicides can control the disease well but appearance of resistant strains of pathogens to reduce fungicide efficiency in controlling disease and producers' access to effective fungicides from various chemical groups, while helping gardeners to reduce the economic damage caused by the disease, reduces the possibility of pathogen resistance to fungicides. The aim of this study was to determine the efficacy of Boscalid + Pyraclovastrobin (Bellis <sup>®</sup> WG38%) (Manufactured by BASF Co.) (With doses of 0.4, 0.7 and 1 ml L<sup>-1</sup>) compared with Tri-floxystrobin + Fluopyram (Luna Sensation <sup>®</sup>) (with a dose of 0.2 ml L<sup>-1</sup>), Tri-floxystrobin (Flint <sup>®</sup> WG50%) (0.2 ml L<sup>-1</sup>) and Tri-floxystrobin + Teboconazol (Nativo <sup>®</sup> WG50%) (With a dose of 0.2 ml L<sup>-1</sup>) to control apple powdery mildew disease.
<strong>Materials and Methods:</strong> For the experiment, the apple orchard of Golden Smooth cultivar with a history of powdery mildew in Ardabil province was selected. The experiment was carried out in a randomized complete block design (RCBD) with 8 treatments and 4 replications. Control treatments were without any spraying and with water spraying. Treatments were applied at three stages (full green bud stage and followed up at pink flowers stage and 10 days after the 2nd spraying). Ten days after the first symptoms of the disease were observed on the control treatments, samples were taken from the sheets and the percentage of the disease incidence and disease severity percentage were calculated. After calculating the incidence and disease severity of apple powdery mildew for each plot, the corresponding values in SAS statistical software were analyzed and the means of both traits were compared by Duncan's multiple range test at one percent probability level.
<strong>Results and Discussion:</strong> The results of analysis of variance of the data obtained from the evaluation of the leaves of the treated trees showed that the effect of treatments on reducing the percentage of disease severity and disease incidence is statistically significant. The results showed that Bellis <sup>®</sup> fungicide with a concentration of 0.1 and 0.7 ml L<sup>-1</sup>, Luna Sensation <sup>®</sup> 0.2 ml L<sup>-1</sup>, Nativo <sup>®</sup> 0.2 ml L<sup>-1</sup> and Flint <sup>®</sup> with a concentration of 0.2 ml L<sup>-1 </sup>had a high efficiency of controlling apple powdery mildew disease. The efficacy of new Bellis <sup>®</sup> fungicide with concentrations of 1 and 0.7 ml L<sup>-1 </sup>was 76 and 60 percent, respectively. According to the obtained results, Bliss fungicide with a dose of 0.4 per thousand had poor efficacy in controlling the severity and occurrence of the disease and was not statistically significantly different from the control treatments. The results also showed that there was no significant difference between the control treatments (treatment with water spraying and treatment without spraying).
<strong>Conclusion:</strong> Because both Bellis <sup>®</sup> concentrations are effective in controlling the disease, therefore in order to protect the health of the fungicide users, the consumer of sprayed products and the environment as well as reduction in costs, the preferred dose is 0.7 ml L<sup>-1</sup>.بیماری سفیدک پودری سیب یکی از مهمترین بیماریهای سیب است که انتشار جهانی دارد و عامل بیماری آن، قارچ<em>Podosphaera leucotricha</em> Ell. Et Ev.<em> </em><em> </em>میباشد. هدف از این مطالعه، تعیین میزان کارآیی قارچکش بوسکالید + پیراکلواستروبین (بلیس<sup>®</sup><sup> </sup>WG38%) (ساخت شرکت ب آ اس اف) (با دزهای 0/4، 0/7 و 1 در هزار) در مقایسه با قارچکشهای تریفلوکسیاستروبین + فلوپیرام (لوناسنسیشن<sup>®</sup> SC 500) (0/2 در هزار)، تریفلوکسیاستروبین (فلینت<sup>®</sup><sup> </sup>WG50%) (0/2 در هزار) و تریفلوکسیاستروبین + تبوکونازول (ناتیوو<sup>®</sup> WG50%) (0/2 در هزار) برای کنترل بیماری سفیدک پودری سیب است. آزمایش در قالب طرح بلوکهای کامل تصادفی با هشت تیمار و هر تیمار با چهار تکرار در استان اردبیل اجرا شد. تیمارهای شاهد شامل تیمار با آبپاشی و تیمار بدون آبپاشی بودند. ده روز پس از مشاهده اولین علائم بیماری در تیمار شاهد از برگها نمونهبرداری شد و درصد وقوع بیماری و درصد شدت بیماری محاسبه گردید. نتایج نشان داد قارچکشهای بلیس<sup>®</sup> با دز یک و 0/7 در هزار، لوناسنسیشن<sup>®</sup> 0/2 در هزار، ناتیوو<sup>®</sup> 0/2 در هزار و فلینت<sup>®</sup> 0/2 در هزار از کارآیی بالایی در کنترل بیماری سفیدک پودری سیب برخوردار بودند. کارآیی قارچکش جدید بلیس<sup>®</sup> در دزهای یک و 0/7 در هزار به ترتیب معادل 76 و60 درصد به دست آمد. از آنجا که هر دو دز بلیس<sup>®</sup> کارآیی مطلوبی در کنترل بیماری دارند، لذا برای محافظت از سلامت کاربر قارچکش، مصرفکننده محصولات سمپاشی شده و محیط زیست و همچنین کاهش هزینهها، دز 0/7 در هزار توصیه میگردد.دانشگاه فردوسی مشهدپژوهش های حفاظت گیاهان ایران2980-817035420220121Evaluating the Reaction of some Non-hybrid and Hybrid Tomato Cultivars to Bacterial Speck Diseaseبررسی واکنش چند رقم غیرهیبرید و هیبرید گوجهفرنگی به بیماری خالزدگی باکتریایی4094204054010.22067/jpp.2021.67720.1000FAافسانه عباس پور انبیدانشآموخته کارشناسی ارشد رشته بیماریشناسی گیاهی، گروه گیاهپزشکی، دانشکده کشاورزی و منابع طبیعی، دانشگاه ارومیه، ارومیه، ایران.مریم خضریاستادیار مؤسسه تحقیقات گیاهپزشکی کشور، سازمان تحقیقات، آموزش و ترویج کشاورزی، تهران، ایرانJournal Article20201230<strong>Introduction: </strong>Tomato bacterial speck caused by <em>Pseudomonas syringae</em> pv. <em>tomato</em>,<em> </em>is one of the several tomato diseases in the world. The disease can seriously affect the quantity and quality of this high-consumption crop in its cultivated areas. Disease symptoms included black spots surrounded by yellow halo on the leaves and small block spot on fruits surface. The spots on ripe fruits may surround with yellow haloes. It is difficult to diagnose the disease via symptoms, because there is high similarity among symptoms of bacterial speck and other tomato bacterial leaf spot diseases, especially bacterial spot caused by <em>Xanthamonas</em> spp. and <em>Pseudomonas syringae</em> pv. <em>syringae</em>. The disease is seed-borne, and application of bacterial-free seeds is the most effective strategy to reduce disease damage. Besides using healthy seed and seedling, other strategies such as applying resistant cultivars, crop rotation, drip irrigation and using pesticides are common procedures in integrated disease management
<strong>Materials and Methods: </strong>In this study, the reaction of 24 tomato cultivars including 13 non-hybrid cultivars (Early Urbana 111, Early Urbana Y, King stone, Super 22 TO, CalJ N3, 2270, Rio grenade, Early Urbana, Primo early, Falat CH, Super Chef, Primax and Red Stone, and 11 hybrid cultivars (Hyb. Superset, Hyb. Firenze, Hyb. Comodoro, Hyb. Bellariva, Hyb. 1585, Hyb. Kishmat, Hyb. Eden, Hyb. 8320, Hyb. Monty marker F1 and Hyb. Ferguson F1) was evaluated against bacterial speck disease in greenhouse. Four pathogenic <em>P. syringae</em> pv. <em>tomato</em> strains isolated from tomato fields in West Azarbaijan province, northwest of Iran, used in all experiments. For inoculation, bacterial suspension of 10<sup>7</sup> CFU ml<sup>−1 </sup>(OD<sub>600</sub>)<sup> </sup>was sprayed on the foliage of tomato seedling at four-five leaf stage. Inoculated seedlings were monitored daily for 21 days, and symptoms were recorded. The indexes of disease severity (DS), time of the first disease symptoms appearance and the area under the disease progress curve (AUDPC) were determined. To assess the disease severity, spots were counted on six leaves of each plant, and the index from zero to six was used, where 0) without symptom, 1) 1-10 spots, 2) 11-15 spots, 3) 16-20 spots, 4) 21-25 spots, 5) 26-30 spots and 6) more than 30 spots on leaves. Experiments were conducted in a completely randomized design, and four pots with four seedlings in each pot were considered for each treatment (cultivar). Statistical analysis of data was performed via Tukey’ HSD test using SAS software (version 9.4). The AUDPC index was calculated using R (version 3.5.2) and Agricolae package. Correlation among studied indexes was evaluated via Spearman’s rank correlation coefficients in SPSS (version 25).
<strong>Results and Discussion: </strong>Analysis variance of data indicated the significance at 1% level among the studied indexes. Positive correlation observed between AUDPC and the time of the first symptoms appearance (r=0.71), as well as the disease severity index (r=0.76), but there was no significant correlation between the time of the first symptoms appearance and the disease severity indexes (r=0.22). According to all three indexes cv. Hyb.1585 determined as a resistant cultivar and cv. Hyb. 8320 were identified as disease susceptible cultivar. However, some cultivars such as cv. Hyb. Firenze was susceptible based on the disease severity index but it considered as a resistant cultivar based on the time of the first disease symptoms appearance index. The results of previous research on tomato bacterial speck disease have shown different degrees of disease severity in various cultivars. So far, several resistant cultivars against this disease have been reported. The response of 93 different tomato cultivars growing in the Mediterranean region of Turkey was examined and seven cultivars showed resistance against <em>P. syringae</em> pv. <em>tomato</em>. Six of these cultivars included Atalay, Party, Petrus, Piccadilly, Prenses and they had the <em>Pto</em> gene, which encodes proteins related to resistance against the disease. Overall, based on the findings of this study, hybrid cultivars of Hyb. 1585, Hyb. Superset, King stone, Hyb. Bellariva and Hyb. Firenze, and non-hybrid cultivar Super Chef showed higher resistance to tomato bacterial speck disease in compare to other studied cultivars.
<strong>Conclusion: </strong>According to the results of this study, the resistance to this pathogen depends on various genetic and physiological factors, as well as plant-pathogen interactions. Application of different disease indexes in evaluating the cultivars reaction to diseases is recommended which can be effective in the final decisions for diseases management.بیماری خالزدگی باکتریایی گوجهفرنگی که توسط باکتری<em> </em><em>Pseudomonas syringae </em>pv. <em>tomato</em> ایجاد میشود، یکی از بیماریهای مهم گوجهفرنگی در جهان و ایران است که میتواند به طور جدی میزان عملکرد و کیفیت محصول را تحت تاثیر قرار دهد. این بیماری بذربرد است بنابراین موثرترین راهکار در کنترل بیماری، استفاده از بذر و نشاء سالم و عاری از باکتری میباشد اما از روشهای دیگری از قبیل استفاده از ارقام مقاوم یا متحمل، رعایت اصول بهداشتی، تناوب کاشت و کاربرد سموم باکتریکش، نیز در مدیریت تلفیقی بیماری استفاده میشود. در این پژوهش، واکنش 24 رقم (غیرهیبرید و هیبرید) گوجهفرنگی در برابر بیماری خالزدگی باکتریایی در محیط گلخانه مورد مطالعه قرار گرفت. برای این منظور، از گیاهچههای چهار تا پنج برگی گوجهفرنگی استفاده شد و مایهزنی به صورت اسپری سوسپانسیون (OD<sub>600</sub>) CFU ml<sup>-1</sup> 10<sup>7</sup>×1 باکتری بیماریزا روی گیاهچهها انجام شد. در بررسی مقاومت ارقام مورد مطالعه، زمان ظهور اولین نشانههای بیماری، شدت بیماری ایجاد شده و سطح زیر منحنی پیشرفت بیماری (AUDPC) مورد ارزیابی قرار گرفت. نتایج نشان داد، شاخص AUDPC با زمان ظهور اولین نشانههای بیماری (0/71=r) و شاخص شدت بیماری (0/76=r) همبستگی مثبت داشت اما زمان ظهور اولین نشانههای بیماری با شدت بیماری (0/22=r) همبستگی معنیداری نداشت. بر اساس یافتههای این پژوهش، نتایج حاصل از ارزیابی چند شاخص مختلف در بررسی واکنش ارقام گیاهی به بیماریها، اطلاعات دقیقتری در رابطه با میزان حساسیت یا مقاومت ارقام به بیماری ارائه میدهد. در این مطالعه، ارقام هیبرید Hyb. 1585، Hyb. Superset، King stone، Hyb. Bellariva وHyb. Firenze، همچنین رقم غیرهیبرید Super Chef، بهعنوان ارقام با مقاومت بالاتر در برابر بیماری خالزدگی باکتریایی گوجهفرنگی ارزیابی شدند که استفاده از این ارقام در مدیریت تلفیقی این بیماری توصیه میگردد.دانشگاه فردوسی مشهدپژوهش های حفاظت گیاهان ایران2980-817035420220121Distribution and Phylogeny of Grapevine fanleaf virus in Vineyards of Khorasan Razavi Province Based on Coat Protein Regionپراکنش و تحلیل تبارزایی ویروس برگ بادبزنی مو در باغات انگور استان خراسان رضوی براساس پروتئین پوششی4214314040410.22067/jpp.2021.68789.1010FAسارا قارونی کاردانیبخش تحقیقات گیاهپزشکی، مرکز تحقیقات و آموزش کشاورزی و منابع طبیعی استان خراسان رضوی، سازمان تحقیقات، آموزش و ترویج کشاورزی، مشهد، ایران0000-0002-2040-1691محمود رضا کریمی شهریمرکز تحقیقات کشاورزی ومنابع طبیعی خراسان رضویفاطمه آزاد دیسفانیبخش تحقیقات گیاهپزشکی، مرکز تحقیقات و آموزش کشاورزی و منابع طبیعی استان خراسان رضوی، سازمان تحقیقات، آموزش و ترویج کشاورزی، مشهد، ایرانJournal Article20210216<strong>Introduction</strong>: Virus and virus-like diseases cause intensive damage in vineyards all over the world. <em>Grapevine fanleaf virus</em> (GFLV) is one of the most economic important viruses infecting grapevine worldwide. It is a major limiting factor for grapevine productions and reduces fruit quality and shortens the longevity of grapevines in the vineyards. GFLV belongs to the genus <em>Nepovirus </em>in the family <em>Secoviridae </em>and has a bipartite single-stranded positive RNA genome which encapsidated in isometric particles. Both RNA molecules contain a genome-linked viral protein (VPg) at 5' end and a poly (A) tail at 3' end of genome. GFLV is transmitted naturally from grapevine to grapevine by the ectoparasitic nematode <em>Xiphinema</em> <em>index </em>in the vineyard. Fanleaf disease causes three groups of symptoms, including malformation, vein clearing and yellowing. This difference in symptoms is related to diversity in the genome of the virus because in one cultivar can be seen both groups of symptoms. Khorasan Razavi province has the third largest area under grape cultivation in Iran in this study we studied distribution and diversity of GFLV isolates in vineyards of Khorasan Razavi province.
<strong>Materials and Methods</strong>
<strong>Plant material and virus isolates</strong>
During two consecutive growing seasons of 2019 and 2020, a survey was conducted in some of the major areas under the cultivation of grapevine in Khorasan Razavi (Kashmar, Khalilabad, Mohammadiyeh Bardaskan, Neyshabour) at the northeast of Iran. A total of 109 grapevines samples were collected and tested for GFLV infection by enzyme-linked immunosorbent assay (ELISA) as described by Clark and Adams (1977). Total RNA was extracted from petioles of ELISA positive samples using CTAB-PVPP method and were used directly or stored at - 70 <sup>0</sup>C.
<strong>Reverse transcriptase –PCR, cloning and sequencing</strong>
cDNA was synthesized by Thermoresistant MMuLV reverse transcriptase (Parstous, Iran) according to the manufacturer's protocol. RT-PCR using specific primer pairs MpF (5'- AGAAGTCGCTCACGATCTGTGAGG -3') and CpR (5'- ACAAACAACACACTGTCGCC- 3') was amplified 1760 bp fragment corresponding to the complete length of coat protein and 230 nucleotides of 3' proximal end in order to detect infected samples. The RT-PCR products were electrophoresed on 1% agarose gel, stained with Green viewer (Pars tous, IRAN), and visualized by UV light.
The gel extracted PCR products were cloned into, pTG19-T PCR Cloning Vector, (Vivantis, Malaysia) following the manufacturer’s instructions and were transformed to <em>Escherichia coli</em> strain DH5α. Then colony-PCR using M13 and the specific primer pairs were used to confirm the recombinant clones. Random recombinant clones were selected to extract plasmid DNA using a Qiagen Plasmid Miniprep Kit (Qiagen, Germany). Finally, The GFLV coat protein gene has been sequenced in both directions.
<strong>Results and Discussion: </strong>In this study, 109 samples of symptomatic vines were collected from the vineyards of Khorasan Razavi province. 58 samples were confirmed to be infected using indirect ELISA and reverse transcriptase polymerase chain reaction tests. The most symptoms in vineyards were vein banding, leaf malformation, open petiolar sinus, stunting and bushy growth of shoot, zigzagged shoot and double nodes in infected stem. The prevalence of this virus was high in the samples of Mohammadiyeh region. cDAN fragment of GFLV genome with 1760 bp in length corresponding to the GFLV coat protein gene was amplified with specific primers. Full-length sequences of the coat protein gene were recorded in the GenBank. Nucleotide sequence identities of 90-94% were found between the coat protein region of isolates of this study and that of deposited in the GenBank previously. Phylogenetic analysis carried out on the GFLV-CP gene of 5 Iranian GFLV sequences selected in this study showed that GFLV isolates of Iran and the world in the phylogenetic tree were divided into two main groups.
<strong>Conclusion: </strong>The virus has been detected in northwestern, northeastern and southern vineyards in Iran. Probably GFLV originated in Iran, so widespread spread of the virus in these areas is possible. The propagation of infected cuttings has played a major role in the spread of the virus in vineyards. The capsid protein gene is a conserved region and be used in the molecular phylogenetic analysis and it is the sole viral determinant of the specific transmission of GFLV by its vector. Phylogenetic analysis carried out on the GFLV-CP showed that GFLV isolates were separated into two statistically significant clusters: the first one (I) including isolates from Iran, and the second one (II) including isolates from different countries, and Iranian isolates of GFLV have distinct position in phylogentic tree. Furthermore, evidence of divergent evolution was observed between isolates from northwest, northeast and south of Iran. It confirms that genetic makeup of GFLV may be affected by geographical isolation. The percentage of GFLV infected samples in summer was much lower than the samples detected in mid-spring. The results of previous research also indicated that GFLV titer in the grapevines drops during the summer hot season. High genetic diversity has been observed in coat proteins gene, this change may be due to an error in the RNA-dependent RNA polymerase (RdRp) enzyme during amplification or due to recombination events. Geographical area among them has a positive effect on evolution and phylogenetic relationships.ویروس برگ باد بزنی مو (<em>Grapevine fanleaf virus</em>, GFLV) در تاکستانهای مناطق مختلف دنیا شیوع دارد. علائم ایجاد شده توسط این ویروس اغلب در سه گروه برگ بادبزنی، موزاییک زرد و رگبرگ نواری تقسیمبندی شدهاند که علت تفاوت در ایجاد علائم، به تنوع ژنتیکی جدایهها نسبت داده شده است. شدت علائم ایجاد شده به جدایهی ویروس، حساسیت رقم مو و شرایط محیطی بستگی دارد. در این تحقیق پراکنش و تحلیل تبارزایی<strong> </strong>ناحیه کدکننده پروتئین پوششی ویروس بررسی شد. نمونهها از تاکستانهای استان خراسان رضوی جمعآوری و ژن پروتئین پوششی از پنج جدایه تکثیر، همسانهسازی و تعیین ترادف گردید. به این منظور، تعداد 109 نمونه برگ دارای علائم از تاکستانها جمعآوری و در آزمون الایزا با استفاده از آنتیبادی اختصاصی GFLV آلودگی به ویروس در 58 نمونه تأیید شد. بیشترین میزان آلودگی در بین نمونههای جمعآوری شده از منطقه محمدیه واقع در شهرستان کاشمر بود. با استفاده از آغازگرهای اختصاصی قطعهای بطول 1760 جفت باز مربوط به طول کامل ناحیه کدکننده پروتئین پوششی ویروس و قسمتی از انتهای'3 ژنوم تکثیر شد. پروتئین پوششی جدایههای انتخاب شده در سطح نوکلئوتیدی و آمینواسیدی بهترتیب 94-90 و 97-91 درصد با جدایههای سایر نقاط دنیا شباهت داشت. تحلیل تبارزائی بر اساس ناحیه کد کننده پروتئین پوششی، جدایههای ایرانی GFLV را در شاخهای مجزا از جدایههای سایر نقاط دنیا قرار داد. همچنین جدایههای شمال شرق کشور در گروهی مجزا از جدایههای شمال غرب کشور قرار گرفتند، که نشاندهنده اثر جدایی جغرافیایی در تکامل GFLV است. نتایج حاصل از این تحقیق بیانگر بومی بودن GFLV در ایران و گسترش احتمالی آن از این منطقه به سایر نقاط جهان است.دانشگاه فردوسی مشهدپژوهش های حفاظت گیاهان ایران2980-817035420220121The Effect of Simultaneous Application of Trichoderma harzianum and Plant Mulch on Yield and Physiological Characteristics of Wheat (cv. Narin)بررسی تأثیرکاربرد همزمان Trichoderma harzianum و مالچ گیاهی بر عملکرد و خصوصیات فیزیولوژیکی گندم رقم نارین4334444076310.22067/jpp.2021.70287.1022FAمخدره مهربانیگروه گیاهپزشکی، دانشکده کشاورزی، دانشگاه بیرجندعباس محمدیدانشیار گروه گیاه پزشکی دانشگاه بیرجند0000-0002-3610-6582مسعود خزاعیاستادیار گروه زراعت دانشگاه بیرجندمجید جامی الاحمدیدانشیار گروه زراعت دانشگاه بیرجند0000-0002-8985-1260Journal Article20211008<strong>Introduction:</strong> <em>Trichoderma</em> species are the main causes of decomposition and decay of agricultural residues and are considered for the control of plant pathogens, especially fungi and nematodes in the world. <em>Trichoderma </em>species have the ability to produce microbial enzymes such as xylanases, which are used in the paper and food processing industries. These enzymes improve the digestibility of nutrients in certain diets in ruminants and poultry, where there is no digestive enzyme that can digest the complex carbohydrates in the cell wall. These enzymes have the power to digest and hydrolyze these substances. South khorasan province due to hot and dry climate, water shortage and successive droughts, saline water in agriculture, pests and diseases, soil with low fertility for planting irrigated wheat needs cultivars resistant to these stresses. Narin cultivar is the latest cultivar introduced for this province. The characteristic of this cultivar are more compatibility with salinity stress areas and relative maturity with other wheat cultivars.
<strong>Materials and Methods: </strong>In order to investigate the effect of simultaneous use of <em>Trichoderma harzianum</em> and plant mulch on yield and physiological characteristics of wheat of Narin cultivar and its effect on the interaction of this cultivar with <em>Alternaria alternata</em> in 2019-2020 in Birjand Faculty of Agriculture Research Farm an experiment asComplete randomization block design was performed with four replications. Treatments included control (without application of <em>Trichoderma</em>), <em>Trichoderma</em> as soil application, <em>Trichoderma </em>as leaf application in granulation stage, <em>Trichoderma </em>application as soil and leaf application in granulation stage. In the granulation stage, each experimental unit was divided into two parts and<em> Alternaria </em>leaf spot pathogen treatment at two levels (inoculation in the granulation stage and without inoculation) was considered as a sub-factor in the experiment. The purpose of using the pathogen treatment was to evaluate the effect of <em>Trichoderma</em> in the presence of the pathogen. This fungus was prepared from the archives of the Plant Pathology Laboratory of Birjand University of Agriculture, which had previously been isolated from the wheat of this province. To inoculate this pathogen, a suspension with a concentration of 10<sup>6</sup> spores per ml of <em>A. alternata </em>was used from a 7-day fungus colony on PDA medium and its effect on physiological traits (including total phenol, chlorophyll a, chlorophyll b, carotenoids, total chlorophyll) were investigated. To investigate the effect of different applications of <em>Trichoderma</em> on Narin cultivar from another part of the plot without pathogen treatment was analysis of growth traits, yield and yield components including chlorophyll index, including green and dry stem height, spike length, weight, grain yield, biological yield, number and weight of grains per spike, spikes number and weight per unit area were measured.
<strong>Results and Discussion:</strong> The aim of using pathogen treatment was to evaluate the biological control of <em>Alternaria</em> wheat leaf spot agent by <em>T. harzianum</em> in different methods by using <em>Trichoderma</em> in the presence of <em>Alternaria</em> in comparison with the absence of <em>Alternaria</em> and its effect on physiological traits (including total phenol, chlorophyll a, Chlorophyll b, carotenoids, total chlorophyll) were evaluated. No symptoms of necrosis or leaf chlorosis were observed after pathogen inoculation. Analysis of physiological traits (total phenol, chlorophyll a, chlorophyll b, carotenoids, total chlorophyll) showed that only the simple effect of inoculation or non-inoculation of <em>Alternaria</em> with <em>Trichoderma </em>significantly different (P <0.05) in terms of total phenol content. Due to the presence of <em>Alternaria </em>as a pathogen, it may lead to a reaction of the plant's defense system, and <em>Trichoderma</em> can also increase phenolic compounds to counteract the pathogen. Analysis of growth traits, yield and yield components showed that <em>Trichoderma</em> treatment had no significant effect on any of them.
<strong>Conclusion:</strong><strong> </strong>This study, for the first time showed that <em>A. alternata</em> can cause disease on wheat Narin cultivar. Also, this research studied the effect of <em>T. harzianum</em> on physiological and functional characteristics of wheat Narin cultivar and results demonstrated that <em>T. harzianum</em> can have little effect on these characteristics of Narin cultivar. Concomitant use of <em>Trichoderma </em>in soil and leaves had a greater effect than separate application in roots or leaves. Also, according to other research, the effect of trichoderma varies depending on the environmental conditions including temperature and humidity, soil texture and structure and the type of wheat cultivar.به منظور بررسی تأثیر کاربرد همزمان <em>Trichoderma</em><em> </em><em>harzianum</em> و مالچ گیاهی بر عملکرد و خصوصیات فیزیولوژیکی گندم رقم نارین و تآثیر آن بر روی برهمکنش این رقم با قارچ <em>Alternaria alternata</em><strong><em>،</em></strong> آزمایشی در قالب طرح بلوکهای کامل تصادفی با چهار تکرار انجام شد. تیمارها شامل شاهد (بدون کاربرد<strong><em> </em></strong>تریکودرما هارزیانوم)، <strong><em> </em></strong>تریکودرما خاک کاربرد،<strong><em> </em></strong>تریکودرما<strong><em> </em></strong>برگکاربرد در مرحله دانهبندی،<strong><em> </em></strong>تریکودرما خاک کاربرد توأم با برگکاربرد در مرحله دانهبندی بودند. در مرحله دانه بندی هر واحد آزمایشی به دو بخش تقسیم شد و تیمار بیمارگر عامل لکه برگی در دو سطح (تلقیح اندام هوایی در مرحله دانهبندی و بدون تلقیح) بعنوان فاکتور فرعی در آزمایش در نظر گرفته شد. هدف از کاربرد تیمار بیمارگر بررسی تآثیر قارچ تریکودرما در حضور بیمارگر بود و تأثیر آن بر صفات فیزیولوژیکی (شامل فنل کل، کلروفیل a،<strong> </strong>کلروفیل b، کاروتنوئید، کلروفیل کل) بود جهت بررسی اثر کاربردهای مختلف تریکودرما بر رقم نارین نیز در بخش دیگر کرت که بدون تیمار بیمارگر بود تجزیه و تحلیل صفات رشدی، عملکرد و اجزای عملکرد اندازهگیری شد. پس از تلقیح بیمارگر هیچ گونه علائم بیماری اعم از نکروز یا کلروز برگی مشاهده نشد. تجزیه صفات فیزیولوژیکی نشان داد که تنها میانگین اثر ساده تلقیح یا عدم تلقیح <em>A. alternata</em> با وجود تریکودرما اختلاف معنیداری (P < 0.05) از نظر محتوی فنل کل داشت و نتایج صفات رشدی، عملکردی نشان داد که تیمار <em>T. harzianum</em> بر هیچ کدام اثر معنیداری نداشت. دادههای این تحقیق برای اولین بار نشان داد که <em>A. alternata</em> توانایی ایجاد بیماری برروی گندم نارین را داشت.دانشگاه فردوسی مشهدپژوهش های حفاظت گیاهان ایران2980-817035420220121Evaluation of a Botanical Acaricide Contain Cottonseed and Clove Oils against Two-spotted Spider Mite in Apple Orchards of Iranارزیابی کنهکش گیاهی حاوی روغن پنبه دانه و میخک علیه کنه تارتن دو لکهای سیب4454554074010.22067/jpp.2021.32703.0FAمصطفی میرزائیاستادیار پژوهش بخش تحقیقات جانورشناسی کشاورزی، مؤسسه تحقیقات گیاهپزشکی کشور، سازمان تحقیقات، آموزش و ترویج کشاورزیمحمدرضا نعمت اللهیرکز تحقیقات کشاورزی و منابع طبیعی استان اصفهانهاشم کمالیدانشیار پژوهش، بخش تحقیقات گیاهپزشکی، مرکز تحقیقات و آموزش کشاورزی و منابع طبیعی استان خراسان رضوی، سازمان تحقیقات، آموزش و ترویج کشاورزی، خراسان رضوی، ایرانJournal Article20200201<strong>Introduction: </strong>One of the major pests of apple trees all-around of Iran is two-spotted spider mites (TSM, <em>Tetranychus urticae</em> Koch (1836)). This pest reported from Gorgan and Mazandaran areas for the first time. This cosmopolitan mite is reported in almost all parts of the country and found in all countries of the world on more than 150 economic plant species. This pest has been causing damage to the farmer in various apple orchards in the country every year. Because of high rate of fecundity, high population density, short life cycle and develop resistance to pesticides, TSM is an invasive pest on apple trees and difficult to control. Also, due to the continued use of various broad-spectrum chemical insecticides / Acaricides to controlling this pest, in addition to making the potential of resistance, it has also eliminated natural enemies. Up to date no botanical acaricides has been registered on TSM in apple orchards of Iran. Accordingly, Pestout<sup>®</sup> as a botanical acaricide to control the active stages of TSM at two concentrations and in comparison to spirodiclofen and fenazaquin were evaluated in three provinces of Tehran, Isfahan and Khorasan Razavi in 2018.
<strong><span style="color: black;">Materials and Methods: </span></strong>During 2018, Pestout<sup>®</sup> contain cottonseed and clove oils as a botanical acaricide to control the active stages of TSM at concentrations of 3 and 5 ml/l and in comparison of spirodiclofen SC 24% (Envidor<sup>®</sup>) 0.5 ml/l, fenazaquin SC 20% (Pride<sup>®</sup>) 0.5 ml/l and control (spraying) were evaluated in three provinces of Tehran, Isfahan and Khorasan Razavi in 2018. The experiment was carried out in a randomized complete block design with three replications (each replicate containing two trees variety yellow with the same conditions) for each treatment. Sampling was taken 1 day before and after spraying, at 3, 7 and 14 days’ intervals from 40 leaves of each experimental unit. Then the <span style="color: black;">immature and female adults </span>of spider mites in the leaves were counted and registered by using binocular in Agricultural Zoology Research Laboratory of the Iranian research institute of plant protection and also in Isfahan and Khorasan Razavi provinces. <span style="color: black;">Data obtained from sampling were corrected by Henderson-Tilton formula. The normality of the data was evaluated using SAS software and Kolmogorov-Smirnov test. A</span>fter analysis of variance using one-way ANOVA in SAS software<span style="color: black;"> mean comparison was performed by Duncan’s multiple range test in SAS 9.4 software.</span>
<strong>Results and Discussion: </strong>The analysis of variance showed that there was a significant difference between all treatments with control in three provinces across all days. Based on the results obtained in Tehran province, both concentrations of Pestout (With more than 82% mortality) besides of Envidor (with more than 86% mortality) were most efficient in all days after spraying. In Isfahan province, the efficacy of Pestout in both concentrations were in the same group with Envidor and Pride. On the other hand, no significant differences were observed between the abovementioned treatments in all days. In fact, for all four treatments acceptable performance recorded. In this province, the mean mortality of 3 ml/l Pestout varied between 74% to 80% during the test days and for concentrations 5 ml/l were 77% to 82%. In Khorasan Razavi province, the efficacy of Pestout 5 ml/l on 3, 7 and 14 days after treatment were more than 92%, 94% and 89% mortality, respectively. Also, mean mortality at concentrations 3 ml/l were recorded 84.70%, 89.91% and 82.16%, respectively. Therefore, both concentrations in this province had a good efficacy.
<strong>Conclusion: </strong>Poor orchard management and the effects of climate change, are increasing pest problems, including TSM incidence, in Iranian orchards. Increased chemical pesticide use is leading to greater occurrence of pest resistance, insufficient control and increased production costs are some of the problems. The registration and implementation of low risk and effective botanical pesticides are one of the best methods for solving the problem and make a great IPM program in the orchards. Therefore, in the present study, it can be concluded that Pestout is a good candidate for controlling the two-spotted spider mite on apple trees, and the concentration 3 ml/l of this compound is recommendable in Iran.کنه تارتن دولکهای سیب (<em>Tetranychus urticae</em> Koch) همه ساله در باغات سیب کشور خساراتی را به باغداران تحمیل مینماید. استفاده مداوم از کنهکش/حشرهکشهای شیمیایی طیف وسیع جهت کنترل این آفت، علاوه بر احتمال ایجاد مقاومت، باعث از بین بردن دشمنان طبیعی نیز شده است. همچنین تا به امروز هیچ کنهکش گیاهی بر روی این گونه در ایران ثبت نشده است. در این راستا، کنهکش گیاهی حاوی روغن پنبه دانه و میخک (Pestout<sup>®</sup>) جهت کنترل مراحل فعال این آفت با غلظتهای 3 و 5 در هزار و در مقایسه با سموم رایج اسپیرودیکلوفن با غلظت نیم در هزار، فنازاکوئین با غلظت نیم در هزار و شاهد (آبپاشی) در سه استان تهران، اصفهان و خراسان رضوی مورد ارزیابی قرار گرفت. این آزمایش در قالب طرح بلوک کامل تصادفی و در سه تکرار (هر تکرار شامل دو درخت سیب ده ساله رقم زرد و با شرایط یکسان) برای هر تیمار انجام شد. نمونهبرداری یک روز قبل از سمپاشی و زمان های 3، 7 و 14 روز پس از سمپاشی از هر واحد آزمایشی صورت گرفت. درصد تلفات با فرمول هندرسون-تیلتون محاسبه و پس از تجزیه واریانس مرکب دادهها با استفاده از نرمافزار SAS، مقایسه میانگین درصد کارایی تیمارها با آزمون دانکن صورت گرفت. بر اساس نتایج بدست آمده از سه منطقه هر دو غلظت پستاوت در تمام روزها کارایی بالایی داشته و قابل مقایسه با سموم رایج شیمیایی بودند. بنابراین میتوان گفت که کنهکش پستاوت جایگزین خوبی جهت کنترل این آفت بوده و غلظت 3 در هزار این ترکیب در ایران قابل توصیه میباشد.دانشگاه فردوسی مشهدپژوهش های حفاظت گیاهان ایران2980-817035420220121Use of Microsatellite Markers for Analysis of Genetic Diversity between Populations of Green Lacewings Chrysoperla carnea (Neuroptera, Chrysopidae)نشانگرهای ریزماهوارهای و کاربرد آن در تجزیه و تحلیل تنوع ژنتیکی جمعیتهای بالتوری سبز (Neuroptera:Chrysopidae) (Stephens, 1836) Chrysoperla carnea4574684061710.22067/jpp.2021.67819.1001FAفاطمه عبدالاحدیگروه گیاهپزشکی، پردیس کشاورزی و منابع طبیعی دانشگاه رازی، کرمانشاهعلی نقی میرمویدیاستاد حشره شناسی. گروه گیاه پزشکی دانشگاه رازی کرمانشاه0000-0002-8026-0296صمد جمالیگروه گیاه پزشکی دانشکده کشاورزی دانشگاه رازی کرمانشاهلیلا زارعیگروه زراعت و اصلاح نباتات دانشکده کشاورزی دانشگاه رازی کرمانشاهJournal Article20201229<strong>Introduction:</strong> Green lacewings are active predators of Aphids, Psylids, Mealy bugs. We used ISSR markers with 10 primers to evaluate the genetic polymorphism between populations of <em>Chrysoperla carnea</em> collected in 30 cities of 14 provinces of Iran with different climatic conditions and compared them with specimens of a population from Netherlands. Maximum and minimum of polymorphism were calculated successively of 88.88% for UBC-809 and 33.33% for UBC-886 primers. The Dutch specimens had the smallest genetic distance with populations of Guilan province and the largest genetic distance to Kerman province. The mean number of alleles for Dutch, Guilan and Kerman populations were successively 6.9, 6.6 and 4.1 and mean number of effective alleles were successively 1.48, 1.41 and 1.19.
<strong>Materials and Methods:</strong> 2000 specimens of <em>Chrysoperla carnea</em> collected from alfa alfa plantations in each of 14 provinces of Iran, 27 specimens sampled from each province besides another 27 specimens of a Dutch population acquired from Hamedan center for Science and technology and DNA extracted using Topaz Inc. kit , ISSR marker with 10 primers used. BioRad<sup>®</sup> thermocycler was used for PCR and PCR end product was electrophoresed in 2% Agarose gel and stained with ethidium bromide. Bands photographed using Gel Doc 2000. Hardy-weinberg’s chi square (<strong><em> </em></strong>χ<sup>2</sup>)<sup> </sup> equation was used for evaluate of equilibrium in the number of polymorphic alleles,Shannon and Nei indice for evaluation of heterozygosity, POPGENE for genetic distance , GenAlex 6 for cluster analysis, AMOVA for analysis of inter and intra populations diversity.
<strong>Results and Discussion</strong>: The total number of electrophoresis bands were 64 bands, 43 of them were polymorphic The range of changes of allelic sizes of primers were between 150-1500 bp. Polymorphic information content(PIC) was between 0.302-0.643 the maximum of it belonged to the primerUBC-809 and the minimum belonged to the primer UBC-812 (Table 3). In three populations of Dutch, Guilan and Kerman the maximum of alleles were seen in gene locus of UBC-809 suggesting that it is highly polymorphic, similar findings was found by Barbosa and co-workers. As in Fig (2) the cluster analysis based on use of Jaccard similarity coefficient, the populations clustered in three groups, the Dutch population together with those of Guilan, Mazendaran, Lorestan, East and west Azerbaijan provinces were gathered in the first cluster and populations of Kerman, Sistan and Beluchestan, Isfahan and Fars province were gathered in the second cluster and the populations of Hamedan, Zanjan, Kermanshah, Tehran and Kudistan provinces were in the third cluster. Principal Component analysis was also done, Eigen values, variances percentage and cumulative variances percentages by independent components and the range of variations represented by these components was shown in Table (5). 100% of variations were represented by first ten independent components. The first, second and third components successively represented 27.68,20.57 and 13.01 percentages of all variations.These components independently from each other represented a percent of genetic diversity, not already known. The maximum of Shannon index was seen in gene locus of UBC-809was 0.53 in Guilan province and the minimum 0.04 in Kerman province.These data were conceivable because there were nine alleles in gene locus of UBC-809 in population of Guilan province and two alleles in gene locus of UBC-812 in populations of Kerman province, the same index was calculated 0.58 for Dutch population. The maximum and the minimum of Nei’s index (H) of gene diversity was calculated 0.35for gene locus of UBC-809 in Guilan province and 0.009 for gene locus of UBC-812 in Kerman province successively and for Dutch population the index was 0.39. The maximum and minimum of observed heterozygosity (Ho) was 0.49 in gene locus of UBC-809 in Guilan and 0.031 in gene locus of UBC-812 in Kerman province successively. The maximum and minimum of expected heterozygosity was calculated as 0.579 in gene locus of UBC-809 in Mazendaran province and 0.034 in gene locus of UBC-886 in Hormozgan province successively. Having nine alleles in its gene locus and getting of maximum observed and expected heterozygosity therefore we can consider the UBC-809 primer as the best gene locus to express of gene diversity in all <em>Chrysoperla carnea</em> populations studied in our present study. We used <strong><em>χ</em><sup>2</sup> </strong>of Hardy-Weinberg equilibrium for all alleles studied, and with regard to H0(Equilibrium in alleles frequency in studied populations) the most well adapted status to Hardy-weinberg equilibrium was seen in gene loci of UBC-809, some of populations and gene loci did have Hardy-Weinberg equilibrium but others did have significant biases from this equilibrium which should be attributed to inadequate number of samples chosen (sampling errors) in the studied populations and or existence of non-reproducing alleles. Our study on population genetic diversity of <em>Chrysoperla carnea </em>showed that ISSR-PCR markers are the best to study the polymorphism of populations of this species, did not study hitherto in Iran.The primers used by us in this study for <em>Chrysoperla carnea</em> was equally used for other orders of insects such as Lepidoptera and Coleoptera (UBC-809) and used for order of Hemiptera (UBC-812, UBC-819).
<strong>Conclusion: </strong>More genetic diversity of alleles in populations of <em>Chrysoperla carnea</em> collected from non-treated alfa alfa plantations than those treated with insecticides. Similar results was obtained in Brazil concerning populations of <em>Chrysoperla externa</em>. Our present study on <em>Chrysoperla carnea</em> in Iran showed us the similarity between gene frequencies in the studied provinces, similar results was found for other species of <em>Chrysoperla</em>. Some authors believe that reduction in heterozygotes alleles in population was caused by a reduction in effective number of alleles in that population. The decrease of allele's diversity could bring about a reduction of populations, even species, as well as the reproduction vigor of populations in a new environment. In insect breeding programs a reduction in genetic diversity has an impact of reduction of fitness or even the loss of fitness in such an environment in which those populations should be released. We propose that our research on heterozygosity of populations of <em>Chrysoperla carnea</em> to be continued in more agroecosystems in Iran with a similar or different molecular markers to have more informations about populations genetic diversity and finally to consider a logical management for preserving genetic reservoirs of them.مطالعات کمی روی تنوع و ساختار ژنتیکی دشمنان طبیعی آفتها که به عنوان عوامل کنترل زیستی نیز شناخته میشوند، در کشور انجام شده است. این پژوهش با هدف مقایسه تنوعژنتیکی جمعیتهای بالتوریسبز<em> </em><em>Chrysoperla carnea</em> انجام شد. جمعیتهای مختلف از چهارده استان کشور شامل استانهای آذربایجانشرقی، آذربایجانغربی، اصفهان، کرمان، کرمانشاه، لرستان، مازندران، گیلان، هرمزگان، تهران، کردستان، شیراز، زنجان و همدان جمعآوری شدند. این جمعیتها با جمعیتهای هلندی با استفاده از 10 نشانگر مولکولی ISSR مقایسه شدند. بیشترین درصد چندشکلی مربوط به جایگاه ژنی UBC-809 به میزان 88/88 درصد و کمترین آن متعلق به جایگاه ژنی UBC-886 به میزان 33/33 درصد بود. کمترین فاصله ژنتیکی جمعیت هلندی با جمعیتهای مورد مطالعه، مربوط به جمعیت استان گیلان و بیشترین فاصله ژنتیکی با جمعیت استان کرمان بود. میانگین تعداد آلل، برای جمعیت هلندی، گیلان و کرمان بهترتیب معادل، 6/9، 6/6، 4/1 و میانگین تعداد آلل موثر، 1/48، 1/41 و 1/19 بدست آمد. مطالعه حاضر نشان داد که نشانگرهای ISSR در مطالعه تنوعژنتیکی این حشره کارایی بالایی دارند.دانشگاه فردوسی مشهدپژوهش های حفاظت گیاهان ایران2980-817035420220121Effect of Different Organic and Chemical Compounds on Population Density of Trialeurodes vaporariorum Westwood and Some Secondary Metabolites of Bean Plantتأثیر ترکیبات مختلف آلی و شیمیایی روی تراکم جمعیت سفیدبالک گلخانه و برخی ترکیبات ثانویه گیاه لوبیا4694804035210.22067/jpp.2021.68750.1009FAمحمد کاراموزیانگروه گیاهپزشکی، دانشکده کشاورزی، دانشگاه شهید باهنر، کرمان، ایرانمریم پهلوان یلیگروه گیاهپزشکی، دانشکده کشاورزی، دانشگاه شهید باهنر، کرمان، ایران0000-0001-9490-7591کمال احمدیگروه گیاهپزشکی، دانشکده کشاورزی، دانشگاه شهید باهنر، کرمان، ایرانJournal Article20210213<strong>Introduction:</strong> Greenhouse whitefly, <em>Trialeurodes vaporariorum</em> Westwood (Hemiptera: Aleyrodidae), is a serious pest of a wide range of plants, such as common bean, cucumber, tomato, pepper, lettuce, etc, in both field and greenhouse production. It typically feeds on the underside of leaves, sucking phloem sap from the plant, which causes both direct damage, by overall weakening the plant and reducing yield, and indirect damage, by excreting honeydew, on which sooty mold grows, as well as transmission of several plant viruses. The widespread use of insecticides to control <em>T. vaporariorum </em>has resulted in developing resistance to the insecticides and affected human’s health and safety. The utilization of plant extract and elicitors is an environmentally safe method that is used in the control recently. Therefore, alternative control strategies are required to minimize the harmful effects of insecticides. In order to control this pest, environmentally friendly methods, especially of plant origin are recently considered by researchers. For this regard, the effect of some organic compounds including methanolic and n-hexanic extract of walnut’s husk or dill’s seeds and salicylic acid, individually and in combination with spirotetramat on population density of greenhouse whitefly’s nymphs and some secondary compounds of bean plant were investigated.
<strong>Materials and Methods: </strong>Seeds of common bean, <em>Phaseolus vulgaris</em> L. (Berloty cultivar) were sown and grown in 15-cm-plastic pots in a greenhouse at 25 ± 3°C, 50 ± 10% RH, and a natural photoperiod. For the experiments, potted bean plants at 6-8 leaf stage, highly infested with <em>T. vaporariorum </em>nymphs, were sprayed with 12 different treatments, including: (1) spirotetramat (SP), (2)<strong> </strong>methanolic extract of walnut husk (MW), (3) n-hexanic extract of walnut husk (NW), (4) methanolic extract of dill seed (MD), (5) n-hexanic extract of dill seed (ND, (6) salicylic acid (SA), (7) spirotetramat in combination with salicylic acid (SP+SA), (8) spirotetramat in combination with methanolic extract of dill seed (SP+MD), (9) spirotetramat in combination with methanolic extract of walnut husk (SP+MW), (10) spirotetramat in combination with n-hexanic extract of dill seed (SP+ND), (11) spirotetramat in combination with n-hexanic extract of walnut husk (SP+NW), and (12) water as a control (CO). After five days, the population density of <em>T. vaporariorum</em> nymphs on bean plants leaves was recorded. Furthermore, the effects of tested treatments on the total phenol and flavonoid contents of bean plants were evaluated. For this reason, dried leaves (5 g) from each treatment were used for the preparation of extracts. The total phenolic of the extracts were determined using the Folin - Ciocalteu reagent. Sample and standard readings were made using a spectrophotometer (Lambda 45-UV/Visible) at 765 nm against the reagent blank. Furthermore, the aluminum chloride colorimetric method was used for determination of the total flavonoid content of treatments. For total flavonoid determination, quercetin was used to make the standard calibration curve. The absorbance was read using a spectrophotometer (Lambda 45-UV/Visible) in the wavelengths of 415 nm. Data were analyzed by one-way ANOVA using SPSS 23.0 software. Comparison of means for nymph density using SNK (Student-Newman-Keuls) multi-range test and comparison of means for secondary chemical compositions using Tukey's test at probability level five Percentage occurred.
<strong>Results and Discussion:</strong> Results showed that the population density of greenhouse whitefly and the secondary metabolites of plant were significantly affected by the tested treatments. The lowest number of whitefly’s nymphs was on spirotetramat and spirotetramat in combination with methanolic extract of dill seed and the highest number was on control. Total phenolic contents ranged from 58.96 to 114.07 mg g<sup>-1 </sup>dry weight on different treatments, which the highest and lowest amount of it was obtained in spirotetramat in combination with methanolic extract of dill seed and spirotetramat in combination with n-hexanic extract of walnut husk, respectively. The highest amount of total flavonoid content of bean plants was in spirotetramat in combination with salicylic acid. The results of the present study showed that the density of greenhouse whitefly population in spirotetramate treatment was lower than other treatments but there was no significant difference with the combined treatments and methanolic extract of walnut husk. Also, all the treatments compared to the control significantly changed the population density of this pest and increased the amount of total phenolic compound in bean plant. Therefore, these compounds, especially the methanolic extract of walnut husk, can be used in integrated management programs of this pest.
<strong>Conclusion:</strong> This research could provide valuable information for control of <em>T. vaporariorum</em> in other plants like ornamental plants in the field and greenhouse and thus can be useful for the production of healthy and organic crops. So it can be used in the IPM programs of this pest.سفیدبالک گلخانه،<em>Trialeurodes vaporariorum</em> Westwood یکی از آفات مهم گیاه لوبیای معمولی است. در این تحقیق تاثیر برخی ترکیبات آلی شامل عصاره متانولی پوست گردو (MW)، عصاره انهگزانی پوست گردو (NW)، عصاره متانولی دانه شوید (MD)، عصاره انهگزانی دانه شوید(ND) و اسید سالیسیلیک (SA)، به تنهایی و در ترکیب با آفتکش اسپیروتترامات (SP) روی سفیدبالک گلخانه و برخی ترکیبات شیمیایی ثانویه گیاه لوبیا بررسی شد. آزمایشها در شرایط گلخانه با محلولپاشی تیمارهای مورد بررسی روی گیاهان لوبیا انجام شد. نتایج تحقیق نشان داد که تراکم جمعیت سفیدبالک گلخانه و ترکیبات شیمیایی ثانویه گیاه به طور معنیداری تحت تاثیر تیمارهای آزمایشی بود. میزان فنل کل در تیمارهای مختلف بین 58/96 تا 114/07 میلیگرم بر گرم وزن خشک متغیر بود که بیشترین و کمترین مقدار آن بهترتیب در تیمارهای ترکیب اسپیروتترامات با عصاره متانولی دانه شوید و ترکیب اسپیروتترامات با عصاره انهگزانی پوست گردو بهدست آمد. بیشترین مقدار فلاونوئید کل گیاه لوبیا نیز در تیمار ترکیب اسپیروتترامات با اسید سالیسیلیک بود. نتایج تحقیق حاضر نشان داد که تراکم جمعیت سفیدبالک گلخانه در تیمار اسپیروتترامات به تنهایی کمتر از سایر تیمارها بود اما اختلاف معنیداری نیز با تیمارهای تلفیقی و تیمار عصاره متانولی پوست گردو نداشت. همچنین همه تیمارهای مورد مطالعه در مقایسه با شاهد بهطور قابل توجهی موجب تغییر تراکم جمعیت این آفت و افزایش مقدار فنل کل گیاه لوبیا شدند. بنابراین میتوان از این ترکیبات بویژه عصاره متانولی پوست گردو در برنامههای مدیریت تلفیقی این آفت استفاده نمود.دانشگاه فردوسی مشهدپژوهش های حفاظت گیاهان ایران2980-817035420220121The Effect of Nutritional Interaction between Micronutrient Fertilizers and Capsicum annuum L. on the Population Growth of Aphidoletes aphidimyza Rondani as Predator of Green Peach Aphidتأثیر کوددهی عناصر ریزمغذی در گیاه فلفل دلمه، Capsicum annuum L. بر رشد جمعیت پشه شتهخوار، Aphidoletes aphidimyza Rondani با تغذیه از شته سبز هلو، Myzus persicae (Sulzer)4814944040510.22067/jpp.2021.70745.1028FAمجید میراب بالوگروه گیاهپزشکی، دانشکده کشاورزی، دانشگاه ایلام0000-0003-3536-1511طیبه علی زمانیدانشآموخته دکتری حشرهشناسی گروه گیاهپزشکی، دانشکده کشاورزی، دانشگاه لرستان، لرستان، ایران0000-0002-5221-2406Journal Article20210603<strong><span style="color: black;">Introduction</span></strong>: Bell pepper (<em>Capsicum annuum </em>L.) is an important plant of belong to family Solanaceae with the origin of Mexico, which is a rich source of vitamins and beneficial antioxidants to the health and the immune system. The green peach aphid <em>Myzus persicae</em> (Sulzer) (Hemiptera: Aphididae) is one of the severe important pests of bell pepper in the greenhouse, which cause damage in both direct and indirect by feeding on sap and transmitting of viral diseases. The use of insecticides is the most commonly used method for controlling <em>M. persicae</em>, but in addition to the environmental contaminating, it increased the aphid resistance to chemical pesticides. Biological control is one of the alternative methods compatible with the crop ecosystems and is an important component in integrated pest management programs. The aphidophagous midge, <em>Aphidoletes aphidimyza</em> Rondani is an appropriative and important predator of various species aphids including <em>M. persicae</em>. Also, the quality of host plants on the first level of nutrition have important effect on the eco- physiology characteristics of the predator on the third level of nutrition. In this study, the effect of foliar application of micronutrient fertilizers of iron, zinc, copper and manganese on bell pepper was investigated on the biological and demographic parameters of <em>A. aphidimyza</em> fed on <em>M. persicae</em> in greenhouse conditions.
<strong><span style="color: black;">Materials and Methods: </span></strong>The experiments were done as a completely randomized design with 50 replications per treatments during 2020-2021 in the greenhouse. The foliar application of micronutrient was carried out in four-to six-leaf stages with a certain amount of each fertilizer. At the beginning of the experiment, 100 eggs were considered to investigate the study of biology and the life table parameters of <em>A. aphidimyza</em> reared on the <em>M. persicae</em> fed on in each of the experimental treatments. Then daily, these eggs on the all treatments were monitored for recording incubation duration, survival rate and larval developmental duration (50 larvae). A mixture of aphids of different stages were Placed daily on each leaves treatment to feed of <em>A. aphidimyza</em>. Then, the experiments and the observations continued until the emergence of adult insects. After, a pair of male and female adult insects (15 pairs per treatment) were released into each experimental container containing leaves aphid infestation. Daily, the investigate continued for recording of pre-oviposition and oviposition duration, fecundity, male and female longevity until the death of the last individual. Recording of life table parameters and data analysis was performed using the bisexual life table method in TWOSEX-MSChart software. The results were accomplished by Tukey’s post hoc Honestly Significant Difference (HSD) test for showing the mean comparisons (Mean±SE).
<strong><span style="color: black;">Results and Discussion</span></strong><span style="color: black;">: </span>Based on results, the highest and lowest the intrinsic rate of increase (0.148 and 0.097 / day), the finite rate of population increase (1.160, 1.102 per day) and the net reproduction rate (15.8, and 6.42 offspring/individual) of <em>A. aphidimyza</em> were observed on iron and control treatments, respectively. The results show that there was a significant difference between the different treatments in terms of mean generation time (T) and the highest and the lowest T was obtained on control (19.003 day) and manganese treatment (18.096 day), respectively. Also, the foliar application of micronutrient fertilizers led to reduce the pre-adult time and increase, fecundity, oviposition period and the male and female longevity of <em>A. aphidimyza. </em>The results of this study show that the foliar application of plants with micronutrient fertilizers by improving the growth quality and inducing antibiotic resistance in host plants, has a positive effect on the biology and life table of <em>A. aphidimyza</em>.
<strong><span style="color: black;">Conclusion: </span></strong>The host plants, as the first level of nutrition, have important effects on the predator biology as the third level of nutrition. So, the use of micronutrients by improving the quality of host plants herbivorous insects can be affect the different aspects of the biological characteristics of the higher nutrient level in plant-herbivorous interactions.
Therefore, the foliar application of bell pepper with micronutrient fertilizers along with the use of <em>A. aphidimyza</em> as an appropriative biological control agent for aphids can be effective in integrated management programs of <em>M. persicae</em>.روابط میان گیاه-گیاهخوار-دشمن طبیعی بسیار پیچیده بوده و کیفیت گیاهان میزبان در سطح اول تغذیه میتواند پارامترهای زیستی دشمن طبیعی را در سطح سوم تغذیهای تحت تأثیر قرار دهد. پشۀ شتهخوار <em>Aphidoletes aphidimyza</em><em> </em>Rondani در مرحلهی لاروی شکارگر اختصاصی گونههای مختلف ها شته از جمله شتۀ سبز هلو <em>Myzus</em> <em>persicae</em> (Sulzer) است.<strong> </strong>در بررسی حاضر، تأثیر محلولپاشی گیاه فلفل دلمه، <em>Capsicum</em> <em>annuum</em> L. با کودهای ریزمغذی آهن، روی، مس و منگنز در مقایسه با شاهد روی پارامترهای زیستی و رشد جمعیت پشۀ شته خوار <em>A. aphidimyz</em>a در تغذیه از شته سبز هلو<em> </em>مورد<em> </em>بررسی قرار گرفت. براساس نتایج به دست آمده، محلولپاشی فلفل دلمه با کودهای ریزمغذی پارامترهای زیستی و جدول زندگی شکارگر را تحت تاثیر قرار داد و منجر به افزایش باروری، طول عمر حشرات کامل نر و ماده و دوره تخمریزی شد. بیشترین و کمترین میزان باروری شکارگر به ترتیب در تیمار آهن (39/5 تخم) و شاهد (24/69 تخم) مشاهده شد. نرخ ذاتی افزایش جمعیت (<em>r</em>) و نرخ متناهی افزایش جمعیت (<em>λ</em>) پشه شته خوار در تیمار آهن بیشترین (بهترتیب 0/148 و 1/160 بر روز) و در شاهد کمترین (بهترتیب 0/097 و 1/102 بر روز) بود. بیشترین و کمترین مقادیر نرخ خالص تولید مثل (<em>R</em><sub>0</sub>) شکارگر نیز به ترتیب در تیمارهای آهن و شاهد (15/8 و 6/42 ماده/ماده/نسل) ثبت شد. همچنین، کمترین میانگین طول یک نسل (<em>T</em>)،<em>A</em>. <em>aphidimyza</em> در تیمار منگنز (18/096 روز) به دست آمد. بنابراین، استفاده از عناصر ریزمغذی با بهبود کیفیت گیاهان میزبان حشرات گیاهخوار میتواند با تأثیر مثبت بر زیستشناسی و جدول زندگی شکارگر <em>A. aphidimyz</em>a در برنامههای مدیریت تلفیقی شته سبز هلو مورد استفاده موثر قرار گیرد.دانشگاه فردوسی مشهدپژوهش های حفاظت گیاهان ایران2980-817035420220121Effect of Time and Burial Depth on Breaking Seed Dormancy and Percentage of Germination of Myagrum (Myagrum perfoliatum L.) Weed Seedsتأثیر مدت زمان و عمق دفن بر شکست خواب و درصد جوانهزنی بذور علف هرز میاگروم (Myagrum perfoliatum L.)4955044038910.22067/jpp.2021.70381.1023FAفیروزه شریفی کالیانیدانشجوی دکتری زراعت، گروه زراعت و اصلاح نباتات، دانشکده کشاورزی، دانشگاه کردستانسعید جلالی هنرمنددانشیار گروه زراعت و اصلاح نباتات، دانشکده علوم و مهندسی کشاورزی، پردیس کشاورزی و منابع طبیعی، دانشگاه رازی، کرمانشاه، ایرانایرج نصرتیگروه زراعت و اصلاح نباتات، دانشکده علوم و مهندسی کشاورزی، پردیس کشاورزی و منابع طبیعی، دانشگاه رازی، کرمانشاه، ایرانعلیرضا باقریدانشگاه رازی کرمانشاهحسن حیدریاستادیار گروه زراعت و اصلاح نباتات، دانشکده علوم و مهندسی کشاورزی، پردیس کشاورزی و منابع طبیعی، دانشگاه رازی، کرمانشاه، ایرانJournal Article20210512<strong>Introduction:</strong> The internal factors of seeds and the conditions outside the seeds can affect the germination and emergence of seeds. In some cases, environmental conditions are suitable for seed to germinate, while the seeds do no seed dormancy which is regarded to be one of the factors in seed survival. Seeds are exposed to different conditions of temperature fluctuations, moisture fluctuations, activity of microorganisms, etc. by being located at different depths of the soil. For instance, seeds that are located in the surface layers of the soil are more exposed to soil moisture fluctuations, which may also affect their dormancy. The results of various experiments have shown that in addition to the depth of burial of seeds, their burial time also affects their germination. Due to the fact that no experiments have been performed on the germination of myagrum weed seeds in this field, this study was conducted to investigate the effect of time and burial depth on breaking seed dormancy and percentage of germination of myagrum.
<strong>Materials and Methods: </strong>This study aimed to investigate the effect of burial time and burial depth on breaking seed dormancy and germination of myagrum seeds in factorial experiment based on a randomized complete block design with 4 replications in the research farm of Razi University of Kermanshah in 2014-2015. Experimental factors include burial time (270, 360 and 420 days), burial depth (0, 5, 10, 20 and 40 cm), temperature (25 ° C, 5/10 and 10/20 °C variable temperature) and light (light and dark). In June 2014, myagrum seeds were collected from plants that had become mature and were in the full mature stage stored in plastic nylon at 25 °C until the seeds were tested. At the beginning of the experiment, the seeds were packed in lace bags that had small pores from which the seeds could not exit and then placed at different depths of the farm soil. 340 seeds were placed in each lace bag. The lace bags were such that the seeds were exposed to the moisture, temperature and chemical regimes of the soil. To make it easier to exit the lace bags from the soil, a thread was attached to each bag that was placed on the soil surface. After each level of burial time in the soil (270, 360 and 420 days), lace bags were exited from different depths. Firstly, the number of germinated seeds in each lace bag was counted and the germination percentage was calculated. Germinated seeds were then removed from the bags and the residual of seeds was transferred to the Agriculture Laboratory of the Agricultural and Natural Resources Campus of Razi University. The results of Mondani et al. (16) study showed that myagrum seeds have physiological dormancy and mechanical dormancy due to hard outer shell. Therefore, seeds do not germinate included damaged seeds and seeds had physiological dormancy and mechanical dormancy. Extracted seeds (not germinated seeds) from different depths in each burial time were disinfected in sodium hypochlorite solution (2%) for ten minutes. Then, to ensure the viability of the seeds, a number of seeds of any depth were randomly selected and tested using tetrazolium solution (0.1%). The appearance of red color indicated the existence of respiration and viability of the seeds (13). To remove the mechanical dormancy caused by the hard outer shell in the seeds, the outer shell of the seeds was removed and then the seeds were placed in sterile petri dish with a diameter of 7 cm containing Whatman No. 1 filter paper and 5 ml of distilled water (30 seeds were placed in per petri dish) and to prevent water evaporation, the petri dishes were closed with parafilm. The petri dishes were then exposed to different temperatures (25 °C, 5/10 and 10/20 °C variable temperature) inside the germinator and in light and dark conditions. To exert the effect of darkness, petri dishes were wrapped in an aluminum foil. After 14 days, the number of germinated seeds in each petri dish was counted. Germination criterion was visible root exit. Finally, data analysis was performed by SAS (version 9.4) software and mean comparisons were performed based on Duncan at 5% probability.
<strong>Results and Discussion:</strong> The results showed the germination percentage of myagrum weed seeds in light and dark were not significantly difference, and also seed burial time, temperature, burial depth and burial time * temperature interaction had a significant effect (p ≤ 0.01) on the germination percentage. The highest germination percentage was observed after 420 days of burial at a variable temperature of 10/20 °C. Also, at the soil surface and with the increasing seed burial depth (more than 5 cm) the survival and seed germination percentage decreased compared to soil depth of 5 cm because seeds need special moisture and temperature conditions for germination. According to the results, these conditions existed at a depth of 5 cm in the soil, so it can be concluded that deep plowing and going -deep seeds may help to manage this weed.
<strong>Conclusion:</strong> Considering that the highest germination percentage was observed in the temperature regime of 10/20 °C, it can be assumed that this weed can be problematic in summer and autumn crops because this temperature range synchronizes in late winter and early spring. On the other hand, it is possible to control this weed in wheat fields. In fact, in wheat fields, herbicides such as 2,4-D and MCPA are used to control broad-leaf weeds in late March and early April, when the temperature is about 10/20 ° C and the time of germination and emergence of myagrum is used. However, if this weed appears in chickpea fields, it is difficult to control because there is no specific herbicide in chickpea fields to control broadleaf weeds, including myagrum. Also, as the depth of burial increased, the germination percentage of the seeds decreased, so deep plowing and deepening of the seeds may help to manage this weed.میاگروم با نام علمی <em>Myagrum perfoliatum</em> L. علف هرزی زمستانه است که در ایران و بویژه در استان کرمانشاه در محصولات زمستانه و پاییزه مانند گندم و جو مشکلساز شده است و جمعیت آن رو به افزایش است اما متأسفانه علیرغم خسارت و پراکنش بالای میاگروم، مطالعات زیادی راجع به اکولوژی، فیزیولوژی و بیولوژی آن انجام نشده است. بنابراین این آزمایش در سال زراعی 94-1393 با هدف بررسی تأثیر مدت زمان و عمق دفن بذر بر شکست خواب و جوانهزنی بذور علف هرز میاگروم بهصورت فاکتوریل در قالب طرح بلوکهای کامل تصادفی با چهار تکرار در مزرعه تحقیقاتی پردیس کشاورزی و منابع طبیعی دانشگاه رازی کرمانشاه اجرا شد. فاکتورهای مورد بررسی در آزمایش شامل مدت زمان دفن بذور در خاک (270، 360 و 420 روز)، عمق دفن بذور (صفر، 5، 10، 20 و 40 سانتیمتر)، دما (25 درجه سانتیگراد ثابت، 5/10 و 10/20 درجه سانتیگراد متغیر) و نور (نور و تاریکی) بودند. نتایج نشان داد که درصد جوانهزنی بذور علف هرز میاگروم در نور و تاریکی اختلاف معنیداری نداشتند، همچنین زمان دفن بذور، دما، عمق دفن بذور و اثر متقابل زمان دفن*دما اثر معنیداری (p≤0.01) بر درصد جوانهزنی بذور گذاشت. بالاترین درصد جوانهزنی (69/5 درصد) با گذشت زمان دفن 420 روز و در دمای 20/10 درجه سانتیگراد متغیر مشاهده شد، همچنین در سطح خاک و با افزایش عمق دفن بذور (بیشتر از 5 سانتیمتر) زنده مانی و درصد جوانهزنی بذور در مقایسه با عمق 5 سانتیمتری خاک کاهش یافت (بهترتیب 50/49، 51/76، 54/36 و 67/99 درصد کاهش درصد جوانهزنی در عمق 0، 10، 20 و 40 سانتیمتری خاک در مقایسه با عمق 5 سانتیمتری خاک) زیرا بذور برای جوانهزنی به شرایط خاص رطوبتی و دمایی نیاز دارند که بنابر نتایچ بهدست آمده این شرایط در عمق 5 سانتیمتری خاک وجود داشته است پس میتوان نتیجه گرفت که انجام شخم عمیق و رفتن بذور به اعماق ممکن است به مدیریت این علف هرز کمک کند.دانشگاه فردوسی مشهدپژوهش های حفاظت گیاهان ایران2980-817035420220121Intra-specific Variations among Different Canada Thistle (Cirsium arvense L.) Ecotypesتفاوتهای درون گونهای بین اکوتیپهای علفهرز خارلته (Cirsium arvense L.)5055174072010.22067/jpp.2021.72064.1046FAمرجان دیانتدانشکده کشاورزی و صنایع غذایی، دانشگاه آزاد اسلامی، واحد علوم و تحقیقات، تهران، ایرانJournal Article20210919<strong>Introduction</strong>: Canada thistle (<em>Cirsium arvense</em> L.( occurs in pastures and wheat fields and is common in most provinces, where it is considered a major agricultural weed in Iran. Increasing our understanding of the environmental factors that determine Canada thistle emergence can provide strategies to control it. Therefore, in this paper the morphological characteristics of 10 ecotypes collected from different regions of Iran and the effect of temperature on the percentage and rate of emergence of root buds in controlled conditions were investigated. Temperature was considered as the treatment because it is one of the most important factors that fluctuate between the diffusion regions in Iran.
<strong>Materials and Methods:</strong> To evaluate any morphological differences among ecotypes of Canada thistle, root fragments were collected from 10 provinces of Iran in 2020. To reduce the effect of the environment, the roots were propagated again in pots in the greenhouse under controlled conditions. Day and night temperatures were 30 and 15 °C, respectively. The root pieces were then harvested and stored at 5 °C for 3 months. Two 10 cm long roots with same weight and same number of buds were planted in pots containing loamy sandy soil. The pots were irrigated during the experiment and the plants were not exposed to water stress. A Completely Randomized Design was conducted at Science Research Branch, Islamic Azad University. After 70 days plants were harvested. The numbers of leaves and branches on the main shoot and number of capitulum were counted and the root length, height of the main shoot and capitulum length were measured. Data analysis of variance was performed using SAS software and means were compared using protected LSD test. Cluster analysis was performed by calculating the Euclidean distance for grouping populations using SPSS software and its dendrogram was drawn. The root and shoot dry weights were measured after drying at 70 °C for 48 h after harvest. At second experiment, temperatures 1- 38° C were evaluated for studying the effect of temperature on percent and rate of shoot emergence. Base temperature (temperature at which the germination rate is zero) was obtained using the linear regression equation between germination rate and temperature.
<strong>Results:</strong> There were significant differences at morphological traits among Canada thistle ecotypes except capitulum length. Root dry weight varied from 8 g in Gonbad ecotype to 11.5 g in Varamin ecotype. Total dry weight was the lowest in Hamedan and was not significantly different from Mashhad and Gonbad ecotypes. The highest total dry weight belonged to Shiraz ecotype. Cluster analysis grouped 10 ecotypes at four groups. First group consisted of Babol, Gonbad and Moghan ecotypes. Varamin, Shahreza, Mashhad, Hamedan and Shiraz placed at second group. Kermanshah and Dezful were placed at third and fourth groups, respectively. In the next step, the data were correlated into principal components on the correlation matrix. In total, the three main components explained about 80.20% of the total data changes. The first component explained 34.33% of the changes. Main stem height, total dry weight and number of leaves had a positive correlation with this component and shoot dry weight had a negative correlation with it. The second component explained 33.82% of the changes in the total data. Groundwater dry weight and total stem + root length had high coefficients in this component. The third component accounted for 12.03% of the changes, with only the number of capitols in each branch having a high positive correlation with this component. The estimated base temperatures for the emergence of bud root were 5.34, 4.91, 5.98, 5.70, 4.42, 6.52, 3.12, 6.26, 3.80 and 5.91°C for Babol, Varamin, Shahreza, Gonbad, Mashhad, Dezful, Kermanshah, Moghan, Hamedan and Shiraz ecotypes, respectively. Emergence growth degree day for Babol, Varamin, Shahreza, Gonbad, Mashhad, Dezful, Kermanshah, Moghan, Hamedan and Shiraz were 201, 210, 200, 205, 190, 220, 182, 202, 190 and 210, respectively.
<strong>Conclusion:</strong> Temperature had a significant influence on the root of Canada thistle. When the temperature was below 3°C, no emergence occurred. Temperature affected not only the percentage of emergence but also the emergence rate. There was a significant linear relationship between the emergence rate and incubation temperature. High temperature probably causes activation of the enzymatic and physiological function of root buds and increases the rate of mobilization of nutrient reserves to the growing belowground shoots.در ایران خارلته یکی از مهمترین علفهای هرز چند ساله در مزارع گندم، مراتع و زمینهای زراعی در اغلب استانها است. جهت مطالعه تفاوتهای ریخت شناسی 10 اکوتیپ خارلته، دو قطعه ریشه به طول 10 سانتیمتر در گلدانهای 25 کیلوگرمی حاوی خاک شنی-لومی کاشته شدند. بعد از گذشت 70 روز تعداد برگها و شاخههای ساقه اصلی، تعداد کاپیتول شمارش و طول ریشه، ارتفاع ساقه اصلی، طول کاپیتول و وزن خشک اندازهگیری شد. در آزمایش دوم به منظور مطالعه اثر دما بر درصد و سرعت سبز شدن ریشهها، دماهای 1 تا 38 درجه سانتیگراد مورد بررسی قرار گرفتند. نتایج آزمایشها نشان داد تفاوت معنیداری در تمام صفات مورد بررسی به جزء طول کاپیتول بین اکوتیپها وجود داشت. تجزیه خوشهای اکوتیپها یک نمودار چنگالی با 4 گروه اصلی تولید کرد. گروه اول شامل اکوتیپهای بابل، گنبد و مغان بود. اکوتیپهای ورامین، شهرضا، مشهد، همدان و شیراز در خوشه دوم و اکوتیپهای کرمانشاه و دزفول نیز بهترتیب متعلق به خوشههای سوم و چهارم بودند. در مرحله بعد روی ماتریس همبستگی دادهها تجزیه به مولفههای اصلی انجام شد در کل 3 مولفه اصلی حدود 80/20 درصد تغییرات کلی دادهها را توجیه نمودند. مولفه اول 34/33 درصد تغییرات را توجیه نمود. ارتفاع ساقه اصلی، وزن خشک کل و تعداد برگ با این مولفه دارای همبستگی مثبت بودند و وزن خشک اندام هوایی با آن همبستگی منفی داشت. مولفه دوم 33/82 درصد تغییرات کل دادهها را توجیه نمود. وزن خشک اندام زیرزمینی و طول ساقه + ریشه در این مولفه ضرایب بالایی داشتند. مولفه سوم 12/03 درصد تغییرات را در برگرفت که تنها تعداد کاپیتول در هر شاخه همبستگی بالای مثبتی با این مولفه داشت. دمای پایه تخمین زده شده برای اکوتیپهای بابل، ورامین، شهرضا، گنبد، مشهد، دزفول، کرمانشاه، مغان، همدان و شیراز بهترتیب 5/34، 4/91، 5/98 ،5/70، 4/42، 6/52، 3/12، 6/26 ،3/80 و 5/91 درجه سانتیگراد و درجه روز-رشد سبز شدن 201، 210، 200، 205، 190، 220، 182، 202، 190 و 210 به دست آمد. درک بهتر اثرات افزایش دما بر سبز شدن در شرایط محیطی متغیر توانایی راهکارهای موجود مدیریتی را در مدیریت علفهای هرز بهبود بخشیده و به توسعه راهکارهای جدید میانجامد.