ORIGINAL_ARTICLE
Evaluation of Effect of Different Fungicides on Fungus Podosphaera leucotricha, the Causal Agent of Apple Powdery Mildew Disease
Introduction: Apple (Malus domestica, Borkh) is considered one of the most common popular and favorite deciduous fruit trees cultivated in Iran. Various harmful factors affect the performance of this fruit. Apple powdery mildew disease is one of the most important apple diseases that has a worldwide distribution and causes disease and is caused by the fungus Podosphaera leucotricha Ell. Et Ev. This fungus is an obligate parasite and it can attack to leaves, flowers, fruits and twigs. In the beginning of spring the disease appeared on leaves which are the most susceptible organs. The disease appears on the upperside of infected leaf as powdery white lesions and eventually the infected part of leaf turn brown and infections on the underside of infected leaf result in chlorotic patches. Infected leaves become crinkle, curl and drop prematurely. Although blossom and fruit infections are less common, they are important because infected fruits are small and stunted if they do not drop. P. leucotricha survives the winter as mycelium in vegetative tissues or in infected flower buds. The primary infection starts when infected buds break dormancy and fungus resumes growth and colonizes developing shoots. Spores growing on infected shoots spread nearby and initiate secondary infections. Also it causes early loss of leaves and stop the growth of diseased branches and as a result, the loss of yield. In heavily infected trees, rust can be seen on fruit surface. Powdery mildew infection usually occurs at relative humidity above 70%, and on days when humidity is low, the infection usually occurs at night or in the early morning hours when the humidity is high. Although the use of effective fungicides can control the disease well but appearance of resistant strains of pathogens to reduce fungicide efficiency in controlling disease and producers' access to effective fungicides from various chemical groups, while helping gardeners to reduce the economic damage caused by the disease, reduces the possibility of pathogen resistance to fungicides. The aim of this study was to determine the efficacy of Boscalid + Pyraclovastrobin (Bellis ® WG38%) (Manufactured by BASF Co.) (With doses of 0.4, 0.7 and 1 ml L-1) compared with Tri-floxystrobin + Fluopyram (Luna Sensation ®) (with a dose of 0.2 ml L-1), Tri-floxystrobin (Flint ® WG50%) (0.2 ml L-1) and Tri-floxystrobin + Teboconazol (Nativo ® WG50%) (With a dose of 0.2 ml L-1) to control apple powdery mildew disease.
Materials and Methods: For the experiment, the apple orchard of Golden Smooth cultivar with a history of powdery mildew in Ardabil province was selected. The experiment was carried out in a randomized complete block design (RCBD) with 8 treatments and 4 replications. Control treatments were without any spraying and with water spraying. Treatments were applied at three stages (full green bud stage and followed up at pink flowers stage and 10 days after the 2nd spraying). Ten days after the first symptoms of the disease were observed on the control treatments, samples were taken from the sheets and the percentage of the disease incidence and disease severity percentage were calculated. After calculating the incidence and disease severity of apple powdery mildew for each plot, the corresponding values in SAS statistical software were analyzed and the means of both traits were compared by Duncan's multiple range test at one percent probability level.
Results and Discussion: The results of analysis of variance of the data obtained from the evaluation of the leaves of the treated trees showed that the effect of treatments on reducing the percentage of disease severity and disease incidence is statistically significant. The results showed that Bellis ® fungicide with a concentration of 0.1 and 0.7 ml L-1, Luna Sensation ® 0.2 ml L-1, Nativo ® 0.2 ml L-1 and Flint ® with a concentration of 0.2 ml L-1 had a high efficiency of controlling apple powdery mildew disease. The efficacy of new Bellis ® fungicide with concentrations of 1 and 0.7 ml L-1 was 76 and 60 percent, respectively. According to the obtained results, Bliss fungicide with a dose of 0.4 per thousand had poor efficacy in controlling the severity and occurrence of the disease and was not statistically significantly different from the control treatments. The results also showed that there was no significant difference between the control treatments (treatment with water spraying and treatment without spraying).
Conclusion: Because both Bellis ® concentrations are effective in controlling the disease, therefore in order to protect the health of the fungicide users, the consumer of sprayed products and the environment as well as reduction in costs, the preferred dose is 0.7 ml L-1.
https://jpp.um.ac.ir/article_40742_1830aa1108160c7dd34b733966c4f28b.pdf
2022-01-21
399
407
10.22067/jpp.2021.32823.0
Apple
Chemical control
Fungicide
Pyraclostrobin + Boscalid
Resistance
H.
Karbalaei Khiavi
hossein.karbalaei@yahoo.com
1
Ardabil Agricultural and Natural Resources Research and Education Center, Agricultural Research, Education and Extension Organization (AREEO), Ardabil, Iran
LEAD_AUTHOR
H.
Khabbaz- Jolfaee
hkh_jolfaee@yahoo.com
2
Research Assistant Professor, Iranian Research Institute of Plant Protection, Agricultural Research, Education and Extension Organization (AREEO), Tehran, Iran
AUTHOR
H.
Ramazani
ramazani20@yahoo.com
3
Ardabil Agricultural and Natural Resources Research and Education Center, Agricultural Research, Education and Extension Organization (AREEO), Ardabil, Iran
AUTHOR
Al-Rawashdeh Z. 2013. Ability of mineral salts and some fungicides to suppress apple powdery mildew caused by the fungus Podosphaera leucotricha. Asian Journal of Plant Pathology 7: 54-59.
1
2009. FRAC cod list: Fungicides sorted by mode of action (including FRAC code numbering), Fungicides Resistance Action Committee, in: http:// www.frac.info/ [Accessed on 2018- 8-10].
2
2015. UK safety data sheet. In: https://www.agricentre.basf.co.uk/go/Bellis [Accessed on 2018- 10-1].
3
2016. Agricultural Statistics, Ministry of Jihad Agriculture .http://www.agri-jahad.ir
4
Behdad E. 1990. Diseases of Fruit Trees in Iran. Neshat Isfahan Publications. Pp. 293.
5
Berrie A.M., and Xu X.M. 2003. Managing apple scab (Venturia inaequalis) and powdery mildew (Podosphaera leucotricha) using AdemTM. International Journal of Pest Management 49(3): 243-249.
6
Cacaj I., Kelmendi B., Shala N., and Rexhaj B. 2015. Chemical protection of apple against leaf powdery mildew and sustainability to pathogen cultivars according to EU standards. Academic Journal of Interdisciplinary Studies 4: 117-122.
7
Fernández O.D., Torés J.A., de Vicente A., and Pérez G.A. 2010. The QoI Fungicides, the Rise and fall of a Successful Class of Agricultural Fungicides. pp. 203-220 In: Carisse, O. (ed.), Agriculture and biological science “fungicides”. Janeza Trdine, Rijeka. Inc. INTECH Open Access Publisher.
8
Filsouf F., Behdad A., and Hassanpour H. 1998. Study of apple powdery mildew disease and its chemical control in Semirom, 13th Iranian Plant Protection Congress, Karaj, P. 234.
9
Gupta D., and Sharma, J.N. Chemical control of powdery mildew of apple in warmer climates of himachal pradesh India. Acta Horticulture 696: 355-358.
10
Hanifeh S., Afzali H., and Yeganeh Kh. 2014. Evaluation of the effect of Nativo (Nativo WG 75%) on apple powdery mildew in comparison with common pesticides in West Azerbaijan province. Twenty-first Congress of Plant Protection, 1 to 4 September. Orumiyeh.
11
Holdsworth R.P. 1972. European red mite and its major predators: Effects of sulfur. Journal of Economic Entomology 65: 1098-1099.
12
Irani H., and Ashkan M. 1998. The effect of several fungicides to control powdery mildew on apple in West Azerbaijan province. 13th Iranian Plant Protection Congress, Karaj, P. 216.
13
Karimi-Shahri M., and Heydarian A. 2010. Investigation of the effect of tetraconazole fungicide on apple powdery mildew. Final report of Khorasan Razavi Agricultural and Natural Resources Research Center research project, Pp. 12.
14
Keliaei R., Khabbaz Jolfaei H., and Mirkamali H. 2002. Handbook of Pests, Diseases and Weeds, Agricultural Education Publishing, Karaj, Iran, Pp. 144.
15
Khabbaz Jolfaei H., and Azimi Sh. 2011. Guidelines for the correct use of Iranian pathogens in the control of plant diseases (scientific and applied), Iranian Plant Protection Research Institute, Pp. 311.
16
Khabbaz Jolfaei H., Karimi-Shahri M.R., Irani H., and Zaker M. 2016. Evaluation of the efficacy of Luna Sensation® 500 SC fungicide against Podosphaera leucotricha, the disease agent of apple powdery mildew. Final report of the research project of the Iranian Plant Protection Research Institute, Pp. 16.
17
Khabbaz Jolfaei H., Irani H., Karbalaei Khiavi H., Farrokh Eslamloo E., and Abidi A. 2002. Evaluation of the effect of Flint (WG 50%) and Strobi (WG 50%) fungicides and their comparison with common pesticides against apple powdery mildew. Final report of the research project of the Iranian Plant Protection Research Institute, Pp. 10.
18
Marine S.C., Yoder K.S., and Baudoin A. 2010. Powdery Mildew of Apple. The Plant Health Instructor. DOI:10.1094 (PH). J- 1010 – 1021 01. Virginia Polytechnic Institute and State University.
19
Pscheidt J.W., and Ocamb, C.M. 2016. Pacific Northwest Plant Disease Management Handbook [online]. Corvallis, OR: Oregon State University. http://pnwhandbooks.org/plantdisease.
20
Rather T.R., Bhat Z.A., Pandit B.A., Sheikh K., Malik A.R., and Ganai M.A. 2019. Bioefficacy studies of new fungicide molecules (Proquinazid 20 EC) against powdery mildew of apple. Journal of Pharmacognosy and Phytochemistry 8(1): 1963-1965.
21
Turechek W.W., Carroll J.E., and Rosenberger D.A. 2004. Powdery Mildew of Apple. nysipm.cornell.edu/factsheets/treefruit/diseases/pm/apple_pm.pdf.
22
Wang Y., Liu Y., He P., Chen J., Lamikanra O., and Lu J. 1995. Evalution of foliar resistance to Uncinula nacator in China wild Vitis Vitis 34(3): 159-164.
23
Wurms K.V., and Chee A.A. 2011. Control of powdery mildew (Podosphaera leucotricha) in apple seedlings using anhydrous milk fat and soybean oil emulsions. New Zealand Plant Protection 64: 201-208.
24
Yeganeh M. 2017. Pesticides Registered in Iran. Basir Shimi Pars. Pp. 47.
25
ORIGINAL_ARTICLE
Evaluating the Reaction of some Non-hybrid and Hybrid Tomato Cultivars to Bacterial Speck Disease
Introduction: Tomato bacterial speck caused by Pseudomonas syringae pv. tomato, is one of the several tomato diseases in the world. The disease can seriously affect the quantity and quality of this high-consumption crop in its cultivated areas. Disease symptoms included black spots surrounded by yellow halo on the leaves and small block spot on fruits surface. The spots on ripe fruits may surround with yellow haloes. It is difficult to diagnose the disease via symptoms, because there is high similarity among symptoms of bacterial speck and other tomato bacterial leaf spot diseases, especially bacterial spot caused by Xanthamonas spp. and Pseudomonas syringae pv. syringae. The disease is seed-borne, and application of bacterial-free seeds is the most effective strategy to reduce disease damage. Besides using healthy seed and seedling, other strategies such as applying resistant cultivars, crop rotation, drip irrigation and using pesticides are common procedures in integrated disease management
Materials and Methods: In this study, the reaction of 24 tomato cultivars including 13 non-hybrid cultivars (Early Urbana 111, Early Urbana Y, King stone, Super 22 TO, CalJ N3, 2270, Rio grenade, Early Urbana, Primo early, Falat CH, Super Chef, Primax and Red Stone, and 11 hybrid cultivars (Hyb. Superset, Hyb. Firenze, Hyb. Comodoro, Hyb. Bellariva, Hyb. 1585, Hyb. Kishmat, Hyb. Eden, Hyb. 8320, Hyb. Monty marker F1 and Hyb. Ferguson F1) was evaluated against bacterial speck disease in greenhouse. Four pathogenic P. syringae pv. tomato strains isolated from tomato fields in West Azarbaijan province, northwest of Iran, used in all experiments. For inoculation, bacterial suspension of 107 CFU ml−1 (OD600) was sprayed on the foliage of tomato seedling at four-five leaf stage. Inoculated seedlings were monitored daily for 21 days, and symptoms were recorded. The indexes of disease severity (DS), time of the first disease symptoms appearance and the area under the disease progress curve (AUDPC) were determined. To assess the disease severity, spots were counted on six leaves of each plant, and the index from zero to six was used, where 0) without symptom, 1) 1-10 spots, 2) 11-15 spots, 3) 16-20 spots, 4) 21-25 spots, 5) 26-30 spots and 6) more than 30 spots on leaves. Experiments were conducted in a completely randomized design, and four pots with four seedlings in each pot were considered for each treatment (cultivar). Statistical analysis of data was performed via Tukey’ HSD test using SAS software (version 9.4). The AUDPC index was calculated using R (version 3.5.2) and Agricolae package. Correlation among studied indexes was evaluated via Spearman’s rank correlation coefficients in SPSS (version 25).
Results and Discussion: Analysis variance of data indicated the significance at 1% level among the studied indexes. Positive correlation observed between AUDPC and the time of the first symptoms appearance (r=0.71), as well as the disease severity index (r=0.76), but there was no significant correlation between the time of the first symptoms appearance and the disease severity indexes (r=0.22). According to all three indexes cv. Hyb.1585 determined as a resistant cultivar and cv. Hyb. 8320 were identified as disease susceptible cultivar. However, some cultivars such as cv. Hyb. Firenze was susceptible based on the disease severity index but it considered as a resistant cultivar based on the time of the first disease symptoms appearance index. The results of previous research on tomato bacterial speck disease have shown different degrees of disease severity in various cultivars. So far, several resistant cultivars against this disease have been reported. The response of 93 different tomato cultivars growing in the Mediterranean region of Turkey was examined and seven cultivars showed resistance against P. syringae pv. tomato. Six of these cultivars included Atalay, Party, Petrus, Piccadilly, Prenses and they had the Pto gene, which encodes proteins related to resistance against the disease. Overall, based on the findings of this study, hybrid cultivars of Hyb. 1585, Hyb. Superset, King stone, Hyb. Bellariva and Hyb. Firenze, and non-hybrid cultivar Super Chef showed higher resistance to tomato bacterial speck disease in compare to other studied cultivars.
Conclusion: According to the results of this study, the resistance to this pathogen depends on various genetic and physiological factors, as well as plant-pathogen interactions. Application of different disease indexes in evaluating the cultivars reaction to diseases is recommended which can be effective in the final decisions for diseases management.
https://jpp.um.ac.ir/article_40540_3d2d7449fb074f50e23daacef0929ce3.pdf
2022-01-21
409
420
10.22067/jpp.2021.67720.1000
AUDPC
Pseudomonas syringae pv. Tomato
resistance cultivars
Tomato
A.
Abbaspour Anbi
lady.abbaspour@gmail.com
1
Former M.Sc. student of Plant Pathology, Department of Plant Protection, Faculty of Agriculture and Natural Resources, Urmia University, Urmia, Iran.
AUTHOR
M.
Khezri
ma_khezri@yahoo.com
2
Assistant Professor, Iranian Research Institute of Plant Protection, Agricultural Research, Education and Extension Organization (AREEO), Tehran, Iran
LEAD_AUTHOR
Allahyari S., Khezri M., and Sadeghinasab F. 2017. A study on tomato gram-negative pathogenic bacteria in West Azarbaijan. p 279. In: Proceedings of the 1st International and 5th National Congress on Organic vs. Conventional Agriculture. 6-17 August. University of Mohaghegh Ardabili, Ardabil, Iran.
1
Bakir V., Özdemіr Z., and Yardim H. 2012. Reaction of some popular hybrid tomato cultivars grown in Aegean region to bacterial speck disease and determination of disease incidence in Şahnalı, Aydın. The Journal of Turkish Phytopathology 41: 37-42.
2
Blancard D. 2012. A Color Handbook Tomato Diseases, Identification, Biology and Control. 2nd. Academic press, USA. 688 pp.
3
Borkar S.G., and Yumlembam R.A. 2016. Bacterial Diseases of Crop Plants. 1st CRC Press, Boca Raton, USA. 594 pp.
4
Campbell C.L., and Modden L.V. 1990. Introduction to Plant Disease Epidemiology. John Willeyand Sons, New York, USA. 532 pp.
5
Canzoniere P., Francesconi S., Giovando S., and Balestra G.M. 2021. Antibacterial activity of tannins towards Pseudomonas syringae tomato, and their potential as biostimulants on tomato plants. Phytopathologia Mediterranea 60: 23-36.
6
Caruso A., Licciardello G., La Rosa R., Catara V., and Bella P. 2016. Mixed infection of Pectobacterium carotovorum carotovorum and P. carotovorum subsp. brasiliensis in tomato stem rot in Italy. Journal of Plant Pathology 98: 3. doi: 10.4454/JPP.V98I3.062.
7
de Mendiburu F., and de Mendiburu M.F. 2019. Package ‘agricolae’. R Package, Version, 1-
8
2021. The Agricultural Production Domain. Available at: http://www.fao.org/faostat/en/#data/QC [visited 27 August 2021].
9
Fletcher J. 1992. Compendium of Tomato Disease. APS Press, St. Paul, Minnesota, USA, 73 pp.
10
Gullino M.L., Gilardi G., Sanna M., and Garibaldi A. 2009. Epidemiology of Pseudomonas syringae syringae on tomato. Phytoparasitica 37: 461-466.
11
Hibberd A.M., Heaton J.B., Finally G.P., and Dullahide S.R. 1992. A greenhouse method for selecting tomato seedlings resistant to bacterial canker. Plant Disease 76: 1004-
12
Kozik E.U. 2002. Studies on resistance to bacterial speck (Pseudomonas syringae tomato) in tomato cv. Ontario 7710. Plant Breeding 121: 526-530.
13
Le K.D., Kim J., Yu N.H., Kim B., Lee C.W., and Kim J.C. 2020. Biological control of tomato bacterial wilt, kimchi cabbage soft rot, and red pepper bacterial leaf spot using Paenibacillus elgii JCK-5075. Frontiers in Plant Science 11: 775. org/10.3389/fpls.2020.00775.
14
Louws F.J. 2018. Evaluation of biopesticides and biorationals on bacterial canker and bacterial spot disease levels in tomato fresh-market production in North Carolina. Acta Horticalture 1207: 241-248
15
Najeeb S., Ahmad M., Khan R.A.A., Naz I., Ali A., and Alam S.S. 2019. Management of bacterial wilt in tomato using dried powder of Withania coagulan (L) Dunal. Australasian Plant Pathology 48: 183-192
16
Okabe N. 1933. Bacterial disease of plants occurring in Formosa. II. Bacterial leaf spot of tomato. Journal of the Society of Tropical Agriculture 5: 25-36.
17
Preston G.M. 2000. Pseudomonas syringae tomato: the right pathogen, of the right plant, at the right time. Molecular Plant Pathology 1: 263-275.
18
Quaglia M., Bocchini M., Orfei B., D’Amato R., Famiani F., Moretti C., and Buonaurio R. 2021. Zinc phosphate protects tomato plants against Pseudomonas syringae tomato. Journal of Plant Diseases and Protection 128: 989-998.
19
Rossi V. 1999. Effect of host resistance and fungicide sprays against Cercospora leaf spot indifferent sugar beet-growing areas of the Mediterranean basin. Phytopathologia Mediterranea 38: 465-470.
20
Saimin J., Soetjipto, and Hendarto H. 2020. Antioxidant effects of tomato juice on reducing serum malondialdehyde levels in menopausal rats. Pakistan Journal of Nutrition 19: 362-366.
21
Shahriari D., and Rahimian H. 1995. Tomato bacterial speck in Varamin. p 168. In: Proceedings of the 12th Iranian Plant Protection Congress. August 27-September 1. Karaj, Iran. (In Persian with English abstract)
22
Shao X., Tan M., Xie Y., Yao C., Wang T., Huang H., Zhang Y., Ding Y., Liu J., Han L., Hua C., Wang X., and Deng X. 2021. Integrated regulatory network in Pseudomonas syringae reveals dynamics of virulence. Cell Reports 34: doi: 10.1016/j.celrep.2021.108920.
23
Thomas J.E., Geering A.D.W., and Maynard G. 2018. Detection of Candidatus Liberibacter solanacearum in tomato on Norfolk Island, Australia. Australasian Plant Disease Notes 13: 1.
24
Turgut A., and Basim H. 2013. Sensitivity of tomato (Solanum lycopersicum) cultivars from Turkey to bacterial speck (Pseudomonas syringae tomato). African Journal of Biotechnology 12: 1793-1801.
25
Yang W.E.N.C.A.I., and Francis D.M. 2007. Genetics and Breeding for Resistance to Bacterial Diseases in Tomato: Prospects for Marker-Assisted Selection. Genetic Improvement of Solanaceous Crops. Volume 2: tomato. Eds K. Razdan and A.K. Mattoo (eds.) Science Publishers Inc, New Hampshire. pp. 379-419.
26
Yunis H., Bashan Y., Okon Y., and Heniis Y. 1980. Two sources of resistance to bacterial speck of tomato caused by Pseudomonas tomato. Plant Disease 64: 851-852.
27
ORIGINAL_ARTICLE
Distribution and Phylogeny of Grapevine fanleaf virus in Vineyards of Khorasan Razavi Province Based on Coat Protein Region
Introduction: Virus and virus-like diseases cause intensive damage in vineyards all over the world. Grapevine fanleaf virus (GFLV) is one of the most economic important viruses infecting grapevine worldwide. It is a major limiting factor for grapevine productions and reduces fruit quality and shortens the longevity of grapevines in the vineyards. GFLV belongs to the genus Nepovirus in the family Secoviridae and has a bipartite single-stranded positive RNA genome which encapsidated in isometric particles. Both RNA molecules contain a genome-linked viral protein (VPg) at 5' end and a poly (A) tail at 3' end of genome. GFLV is transmitted naturally from grapevine to grapevine by the ectoparasitic nematode Xiphinema index in the vineyard. Fanleaf disease causes three groups of symptoms, including malformation, vein clearing and yellowing. This difference in symptoms is related to diversity in the genome of the virus because in one cultivar can be seen both groups of symptoms. Khorasan Razavi province has the third largest area under grape cultivation in Iran in this study we studied distribution and diversity of GFLV isolates in vineyards of Khorasan Razavi province.
Materials and Methods
Plant material and virus isolates
During two consecutive growing seasons of 2019 and 2020, a survey was conducted in some of the major areas under the cultivation of grapevine in Khorasan Razavi (Kashmar, Khalilabad, Mohammadiyeh Bardaskan, Neyshabour) at the northeast of Iran. A total of 109 grapevines samples were collected and tested for GFLV infection by enzyme-linked immunosorbent assay (ELISA) as described by Clark and Adams (1977). Total RNA was extracted from petioles of ELISA positive samples using CTAB-PVPP method and were used directly or stored at - 70 0C.
Reverse transcriptase –PCR, cloning and sequencing
cDNA was synthesized by Thermoresistant MMuLV reverse transcriptase (Parstous, Iran) according to the manufacturer's protocol. RT-PCR using specific primer pairs MpF (5'- AGAAGTCGCTCACGATCTGTGAGG -3') and CpR (5'- ACAAACAACACACTGTCGCC- 3') was amplified 1760 bp fragment corresponding to the complete length of coat protein and 230 nucleotides of 3' proximal end in order to detect infected samples. The RT-PCR products were electrophoresed on 1% agarose gel, stained with Green viewer (Pars tous, IRAN), and visualized by UV light.
The gel extracted PCR products were cloned into, pTG19-T PCR Cloning Vector, (Vivantis, Malaysia) following the manufacturer’s instructions and were transformed to Escherichia coli strain DH5α. Then colony-PCR using M13 and the specific primer pairs were used to confirm the recombinant clones. Random recombinant clones were selected to extract plasmid DNA using a Qiagen Plasmid Miniprep Kit (Qiagen, Germany). Finally, The GFLV coat protein gene has been sequenced in both directions.
Results and Discussion: In this study, 109 samples of symptomatic vines were collected from the vineyards of Khorasan Razavi province. 58 samples were confirmed to be infected using indirect ELISA and reverse transcriptase polymerase chain reaction tests. The most symptoms in vineyards were vein banding, leaf malformation, open petiolar sinus, stunting and bushy growth of shoot, zigzagged shoot and double nodes in infected stem. The prevalence of this virus was high in the samples of Mohammadiyeh region. cDAN fragment of GFLV genome with 1760 bp in length corresponding to the GFLV coat protein gene was amplified with specific primers. Full-length sequences of the coat protein gene were recorded in the GenBank. Nucleotide sequence identities of 90-94% were found between the coat protein region of isolates of this study and that of deposited in the GenBank previously. Phylogenetic analysis carried out on the GFLV-CP gene of 5 Iranian GFLV sequences selected in this study showed that GFLV isolates of Iran and the world in the phylogenetic tree were divided into two main groups.
Conclusion: The virus has been detected in northwestern, northeastern and southern vineyards in Iran. Probably GFLV originated in Iran, so widespread spread of the virus in these areas is possible. The propagation of infected cuttings has played a major role in the spread of the virus in vineyards. The capsid protein gene is a conserved region and be used in the molecular phylogenetic analysis and it is the sole viral determinant of the specific transmission of GFLV by its vector. Phylogenetic analysis carried out on the GFLV-CP showed that GFLV isolates were separated into two statistically significant clusters: the first one (I) including isolates from Iran, and the second one (II) including isolates from different countries, and Iranian isolates of GFLV have distinct position in phylogentic tree. Furthermore, evidence of divergent evolution was observed between isolates from northwest, northeast and south of Iran. It confirms that genetic makeup of GFLV may be affected by geographical isolation. The percentage of GFLV infected samples in summer was much lower than the samples detected in mid-spring. The results of previous research also indicated that GFLV titer in the grapevines drops during the summer hot season. High genetic diversity has been observed in coat proteins gene, this change may be due to an error in the RNA-dependent RNA polymerase (RdRp) enzyme during amplification or due to recombination events. Geographical area among them has a positive effect on evolution and phylogenetic relationships.
https://jpp.um.ac.ir/article_40404_a5fccfe1942cd457e213c83314eaca9d.pdf
2022-01-21
421
431
10.22067/jpp.2021.68789.1010
distribution
Genetic diversity
Khorasan Razavi and Grapevine fan leaf virus
S.
Gharouni
saragharooni@yahoo.com
1
Plant Protection Research Department, Khorasan Razavi Agricultural and Natural Resources Research Education Center, AREEO, Mashhad, Iran
LEAD_AUTHOR
Mahmoud Reza
Karimishahri
karimi_in@yahoo.com
2
مرکز تحقیقات کشاورزی ومنابع طبیعی خراسان رضوی
AUTHOR
F.
Azaddisfani
f_azaddisfani@yahoo.com
3
Plant Protection Research Department, Khorasan Razavi Agricultural and Natural Resources Research Education Center, AREEO, Mashhad, Iran
AUTHOR
Ahmadi K., Ebadzadeh H., Hatami F., Hosseinpour R., and Abdshah H. 2020. Agricultural statistics of horticultural products in 2019. Third volume. Ministry of Jihad Agriculture, Information and Communication Technology Center. 156 pages.
1
Altschul S.F., Gish W., Miller W., Myers E.W., and Lipman D.J. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403–410.
2
Andret-Link P., Schmitt-Keichinger C., Demangeat G., Komar , and Fuchs M. 2004. The specific transmission of Grapevine fanleaf virus by its nematode vector Xiphinema index is solely determined by the viral coat protein. Virology 320: 12-22.
3
Biebricher C., and Eigen M. 2006. What is a quasispecies? In Quasispecies: Concept and Implications for Virology, 1-31 pp.
4
Clark M.F., and Adams A.N. 1977. Characteristics of the microplate method of the enzyme linked immunosorbent assay for the detection of plant viruses. Journal of General Virology. 34: 474-483.
5
Dijkstra J., and Jager C.P. 1998. Practical plant virology: protocols and exercises. Springer-Verlag GmbH.
6
Gholampour Z., Zakiaghl M., Jafarpour B., and Mehrvar M. 2015. Identification and Prevalence of Grapevine fanleaf virus in Khorasan-Razavi Vineyards. Journal of Plant Protection 29(3): 318-324. doi: 10.22067/jpp.v29i3.27668
7
Gholampour Z., Kargar M., Zakiaghl M., Siampour M., Mehrvar M., and Izadpanah K. 2017. Dynamics of the population structure and genetic variability within Iranian isolates of grapevine fanleaf virus: evidence for polyphyletic origin. Acta Virologica 61(3): 324-335.
8
Hewitt W.B., Raski D.J., and Goheen A.C. 1958. Nematode vector of soil-borne fanleaf virus of grapevines. Phytopathology 48: 586-595.
9
Hewitt W.B., Martelli G.P., Dias H.F., and Taylor R.H. 1970. Grapevine fanleaf virus. C. M. I/ A. B. Descriptions of Plant Viruses. No. 28.
10
Hull 2002. Matthews’ Plant Virology, 4th, Academic Press. London.
11
Kargar M., Zakiaghl M., Masoumi M., Mehrvar M., and Izadpanah K. 2017. Analysis of genetic diversity of Grapevine fanleaf virus isolate from Fars and Kohgiluyeh-Boyer Ahmad provinces. Iranian Journal of Plant Pathology 52(3): 375-391.
12
Kumar S., Stecher G., and Tamura K. 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33(7): 1870-1874.
13
Lu G., and Moriyama E.N. 2004. Vector NTI, a balanced all-in-one sequence analysis suite. Briefings in Bioinformatics 5(4): 378-388.
14
Martelli G.P., and Savino V. 1990. Fanleaf degeneration. In: Pearson, R.C., Goheen, A. (Eds.), Compendium of Grape Diseases. APS Press, St. Paul, MN, USA, pp. 48–49.
15
Martelli G.P. 1993. Grapevine degeneration fanleaf. In: Martelli G.P. (ed.). Graft-transmissible diseases of grapevines. Handbook for detection and diagnosis, pp. 9-18. Food and Agriculture Organization of the United Nations, Rome, Italy.
16
Naraghi-Arani P., Daubert S., and Rowhani A. 2001. Quasispecies nature of the genome of Grapevine fanleaf virus. Journal of General Virology 82(7): 1791-1795.
17
Nourinejhad Zarghani S., Shams-Bakhsh M., Zand N., Sokhandan-Bashir N., and Pazhouhandeh M. 2012. Genetic analysis of Iranian population of Potato leafroll virus based on ORF0. Virus Genes 45: 567-574.
18
Nourinezhad Zarghani SH., Shams-Bakhsh M., Sokhandan-Bashir N., and Pazhouhandeh M. 2012. Identification and detection of Iranian isolates of grapevine fanleaf virus using green-grafting and RT-PCR. Iranian Journal of Plant Pathology 48(3): 381-391.
19
Nourinejhad Zarghani S., Shams‐Bakhsh M., Bashir N.S., and Wetzel T. 2013. Molecular characterization of whole genomic RNA2 from Iranian isolates of Grapevine fanleaf virus. Journal of Phytopathology 161(6): 419-425.
20
Nourinejhad Zarghani S., Karimi M., Nourinejhad Zarghani A., and Hossein Zadeh M.R. 2015. Genetic diversity of and selection pressure on Grapevine fanleaf virus movement protein in Iranian isolates. Plant Protection 38: 38-49.
21
Panno S., Caruso AG., Bertacca S., Pisciotta A., Lorenzo RD., Marchione S., Matić S., and Davino S. 2021. Genetic Structure and Molecular Variability of Grapevine Fanleaf Virus in Sicily. Agriculture 11(6): 496. https://doi.org/10.3390/agriculture11060496.
22
PearsonC., and Goheen A.C. 1988. Compendium of Grape Diseases. APS Press.
23
Pourrahim R., Farzadfar S., Golnaraghi A.R., and Ahoonmanesh A. 2007. Partial molecular characterization of some Grapevine fanleaf virus isolates from North-east of Iran. Journal of Phytopathology 155: 754-757.
24
Ritzenthaler , Viry M., Pinck M., Margis R., Fuchs M., and Pinck L. 1991. Complete nucleotide sequence and organization of grapevine fanleaf nepovirus RNA1. Journal of General Virology 72: 2357-2365.
25
Sanfacon , Wellink J., Le Gall O., Karasev A., van der Vlugt R., and Wetzel T. 2009. Secoviridae: a proposed family of plant viruses within the order Picornavirales that combines the families Sequiviridae and Comoviridae, the unassigned genera Cheravirus and Sadwavirus, and the proposed genus Torradovirus. Archive of Virology 154: 899–907
26
Schneider W.L., and Roossinck M.J. 2000. Evolutionarily related Sindbis-like plant viruses maintain different levels of population diversity in a common host. Journal of Virology 74(7): 3130-3134.
27
Serghini M.A., Fuchs M., Pinck M., Reinbolt J., Walter B., and Pinck L. 1990. RNA2 of Grapevine fanleaf virus: sequence analysis and coat protein cistron location. Journal of General Virology 71: 1433-1441.
28
Sokhandan Bashir N., Hajizadeh M. 2007. Survey for Grapevine fanleaf virus in vineyards of north-west Iran and genetic diversity of isolates. Australasian Plant Pathology 36: 46-52.
29
Sokhandan Bashir N., Nikkhah Sh., and Hajizadeh M. 2007. Distinct phylogenetic positions of Grapevine fanleaf virus isolates from Iran based on the movement protein gene. Journal of General Plant Pathology 73: 209–215.
30
Sokhandan Bashir N., Pashaei A., and Doulati-baneh H. 2011. Characterization of the full length coat protein gene of Iranian Grapevine fanleaf virus isolates, genetic variation and phylogenetic analysis. Iranian Journal of Biotechnology 9(3): 213-221.
31
Sokhandan-Bashir N., and Melcher U. 2012. Population genetic analysis of grapevine fanleaf virus. Archives of Virology 157(10): 1919-1929.
32
Vigne , Bergdoll M., Guyader S., and Fuchs M. 2004. Population structure and genetic diversity within Grapevine fanleaf virus isolates from a naturally infected vineyard: Evidence for mixed infection and recombination. General Virology 85: 2435-2445.
33
Vuittenz 1970. Fanleaf of grapevine. In: N. W. Frazier (ed.). Virus disease of small fruits and grapevine. University of California, Berkeley 217-228.
34
Zaki-Aghl M., and Izadpanah K. 2003. Serological and molecular identification of Grapevine fanleaf virus in Iran. Iranian Journal of Plant Pathology 39: 161-171.
35
Zhou J., Fan X., Dong Y., ping Zhang Z., Ren F., and Hu G. 2015. Detection and genetic variation analysis of Grapevine fanleaf virus (GFLV) isolates in China. Archives of Virology 160(11): 2661-2667.
36
ORIGINAL_ARTICLE
The Effect of Simultaneous Application of Trichoderma harzianum and Plant Mulch on Yield and Physiological Characteristics of Wheat (cv. Narin)
Introduction: Trichoderma species are the main causes of decomposition and decay of agricultural residues and are considered for the control of plant pathogens, especially fungi and nematodes in the world. Trichoderma species have the ability to produce microbial enzymes such as xylanases, which are used in the paper and food processing industries. These enzymes improve the digestibility of nutrients in certain diets in ruminants and poultry, where there is no digestive enzyme that can digest the complex carbohydrates in the cell wall. These enzymes have the power to digest and hydrolyze these substances. South khorasan province due to hot and dry climate, water shortage and successive droughts, saline water in agriculture, pests and diseases, soil with low fertility for planting irrigated wheat needs cultivars resistant to these stresses. Narin cultivar is the latest cultivar introduced for this province. The characteristic of this cultivar are more compatibility with salinity stress areas and relative maturity with other wheat cultivars.
Materials and Methods: In order to investigate the effect of simultaneous use of Trichoderma harzianum and plant mulch on yield and physiological characteristics of wheat of Narin cultivar and its effect on the interaction of this cultivar with Alternaria alternata in 2019-2020 in Birjand Faculty of Agriculture Research Farm an experiment asComplete randomization block design was performed with four replications. Treatments included control (without application of Trichoderma), Trichoderma as soil application, Trichoderma as leaf application in granulation stage, Trichoderma application as soil and leaf application in granulation stage. In the granulation stage, each experimental unit was divided into two parts and Alternaria leaf spot pathogen treatment at two levels (inoculation in the granulation stage and without inoculation) was considered as a sub-factor in the experiment. The purpose of using the pathogen treatment was to evaluate the effect of Trichoderma in the presence of the pathogen. This fungus was prepared from the archives of the Plant Pathology Laboratory of Birjand University of Agriculture, which had previously been isolated from the wheat of this province. To inoculate this pathogen, a suspension with a concentration of 106 spores per ml of A. alternata was used from a 7-day fungus colony on PDA medium and its effect on physiological traits (including total phenol, chlorophyll a, chlorophyll b, carotenoids, total chlorophyll) were investigated. To investigate the effect of different applications of Trichoderma on Narin cultivar from another part of the plot without pathogen treatment was analysis of growth traits, yield and yield components including chlorophyll index, including green and dry stem height, spike length, weight, grain yield, biological yield, number and weight of grains per spike, spikes number and weight per unit area were measured.
Results and Discussion: The aim of using pathogen treatment was to evaluate the biological control of Alternaria wheat leaf spot agent by T. harzianum in different methods by using Trichoderma in the presence of Alternaria in comparison with the absence of Alternaria and its effect on physiological traits (including total phenol, chlorophyll a, Chlorophyll b, carotenoids, total chlorophyll) were evaluated. No symptoms of necrosis or leaf chlorosis were observed after pathogen inoculation. Analysis of physiological traits (total phenol, chlorophyll a, chlorophyll b, carotenoids, total chlorophyll) showed that only the simple effect of inoculation or non-inoculation of Alternaria with Trichoderma significantly different (P <0.05) in terms of total phenol content. Due to the presence of Alternaria as a pathogen, it may lead to a reaction of the plant's defense system, and Trichoderma can also increase phenolic compounds to counteract the pathogen. Analysis of growth traits, yield and yield components showed that Trichoderma treatment had no significant effect on any of them.
Conclusion: This study, for the first time showed that A. alternata can cause disease on wheat Narin cultivar. Also, this research studied the effect of T. harzianum on physiological and functional characteristics of wheat Narin cultivar and results demonstrated that T. harzianum can have little effect on these characteristics of Narin cultivar. Concomitant use of Trichoderma in soil and leaves had a greater effect than separate application in roots or leaves. Also, according to other research, the effect of trichoderma varies depending on the environmental conditions including temperature and humidity, soil texture and structure and the type of wheat cultivar.
https://jpp.um.ac.ir/article_40763_2e6a1ff418a0a30e48950d55e7cbc98f.pdf
2022-01-21
433
444
10.22067/jpp.2021.70287.1022
Alternaria
Leaf spot
Mulch
Phenol
Trichoderma
M.
Mehrabani
mokhadrehmehrabani@gmail.com
1
Department of Plant Protection, Faculty of Agriculture, University of Birjand, Birjand, Iran
AUTHOR
A.
Mohammadi
abbasmohammadi229@gmail.com
2
Associate Professor, Department of Plant Protection, Birjand University
LEAD_AUTHOR
M.
Khazaei
mkhazaei20@yahoo.com
3
Assistant Professor of Agriculture Department, Birjand University
AUTHOR
M.
Jamialahmadi
mjamialahmadi@birjand.ac.ir
4
Associate Professor, Department of Agriculture, Birjand University
AUTHOR
Amini A., Akbari-Moghaddam H., and Afyoni D., Saberi H., and Tabatabai MH. 2018. Narin, a new irrigated wheat cultivar with high adaptability and yield, suitable for areas with soil and water salinity stress in temperate and temperate warm climates of the country. Scientific-Extension Journal of Research Findings in Crops and Horticultural Plants 2(1): 135-147. (In Persian with English abstract)
1
Amini Y. 2014. Taxonomic study of Trichoderma species in South Khorasan province. The thesis for Ms.c Degree of Plant Pathology. Faculty of Agriculture, University of Birjand, Iran. (In Persian with English abstract)
2
Aulakh MS., Manchanda JS., Garg AK., Kumar S., Dercon G., and Nguyen ML. 2012. Crop production and nutrient use efficiency of conservation agriculture for soybean–wheat rotation in the Indo-Gangetic Plains of Northwestern India. Soil and Tillage Research 120: 50-60.
3
Beg Q., Kapoor M., Mahajan L., and Hoondal 2001. Microbial xylanases and their industrial applications: a review. Applied Microbiology and Biotechnology 56(3-4): 326-338.
4
Benhamou N., and Chet I. 1996. Parasitism of sclerotia of Sclerotium rolfsii by Trichoderma harzianum ultrastructural and cytochemical aspects of the interaction. Phytopathology 86: 4: 405-416.
5
Cordo CA., Monaco CI., Segarra CI., Simon MR., Mansilla AY., Perello AE., and Conde RD. 2007. Trichoderma as elicitors of wheat plant defense responses against Septoria tritici. Biocontrol Science and Technology 17(7): 687-698.
6
Donjadee S., and Tingsanchali T. 2016. Soil and water conservation on steep slopes by mulching using rice straw and vetiver grass clippings. Agriculture and Natural Resources 50(1): 75-79.
7
Fischer Santiveri F., and Vidal 2002. Crop rotation, tillage and crop residue management for wheat and maize in the sub-humid tropical highlands: I. Wheat and legume performance. Field Crops Research 79: 2-3: 107-122.
8
Fu J., Liu Z., Li Z., Wang Y., and Yang K. 2017. Alleviation of the effects of saline-alkaline stress on maize seedlings by regulation of active oxygen metabolism by Trichoderma asperellum. PLoS One 12(6): e0179617.
9
Gangwar K., Singh K., Sharma S., and Tomar O. 2006. Alternative tillage and crop residue management in wheat after rice in sandy loam soils of Indo-Gangetic plains. Soil and Tillage Research 88: 1-2: 242-252.
10
Ghorbanli M., and Kiapour A. Copper-induced changes on pigments and activity of non-enzimatic and enzymatic defence systems in Portulaca oleracea L. Iranian Journal of Medicinal and Aromatic Plants 28(2): 235-247. (In Persian with English abstract)
11
Harman GE., Howell CR., Viterbo A., Chet I., and Lorito M. 2004. Trichoderma species opportunistic, avirulent plant symbionts. Nature Reviews Microbiology 2(1): 43-56.
12
Hemmat A., and Eskandari I. 2006. Dryland winter wheat response to conservation tillage in a continuous cropping system in northwestern Iran. Soil and Tillage Research 86: 1: 99-109.
13
Jackson AM, Whipps JM, and Lynch JM. 1991. Effects of temperature, PH and water potential on growth of four fungi with disease biocontrol potential. World Journal of Microbiology Biotechnology 7: 494-501.
14
Khaledi N., and Taheri P. 2016. Biocontrol mechanisms of Trichoderma harzianum against soybean charcoal rot caused by Macrophomina phaseolina. Journal of Plant Protection Research 56(1): 359-365. (In Persian with English abstract)
15
Khan A. 2015. Using films in the ESL classroom to improve communication skills of non-native learners. Elt Voices. 5(4): 46-52.
16
Kolasa M., Ahring BK., Lubeck PS., and Lubeck M. 2014. Co-cultivation of Trichoderma reesei Rut C30 with three black Aspergillus strains facilitates efficient hydrolysis of pretreated wheat straw and shows promises for on-site enzyme production. Bioresource Technology 169: 143-148.
17
Mahato S., Bhuju S., and Shrestha J. 2018. Effect of Trichoderma viride as biofertilizer on growth and yield of wheat. Malaysian Journal of Sustainable Agricultur 2(2): 1-5.
18
Moaven N., Ghorbani R., and Rezaeian-Doloei R. 2012. Investigation on biological control of Russian knapweed (Acroptilon repens) with fungal pathogens. Journal of Agricultural Knowledge and Sustainable Production 24(2): 108-122. (In Persian with English abstract)
19
Mokhtar H., and Aid D. 2013. Contribution in isolation and identification of some pathogenic fungi from wheat seeds, and evaluation of antagonistic capability of Trichoderma harzianum against those isolated fungi in vitro. Agriculture and Biology Journal of North America 4(2): 145-154.
20
Monaco C., Sisterna M., Perello A., and Dal-Bello G. 2004. Preliminary studies on biological control of the blackpoint complex of wheat in Argentina. World Journal of Microbiology and Biotechnology 20(3): 285-290.
21
Peng Z., Ting W., Haixia W., Min W., Xiangping M., Siwei M., and Qingfang H. 2015. Effects of straw mulch on soil water and winter wheat production in dryland farming. Scientific Reports 5: 107-125.
22
Pere J., Siika-aho, M., and Viikari L. 1995. Effects of purified Trichoderma ressei cellulose on the fiber properties of kraft pulp. Journal Tappi Press Atlanta GA (USA) 78(6).71-78.
23
Qasmkhyly f., Pyrdshty h., Bahmanyar M., and Tajik M. 2015. The effect of Trichoderma harzianum and cadmium on tolerance and yield index of wheat (Triticum aestivum). Journal of Ecophysiological Crops 8(32): 465-482. (In Persian with English abstract)
24
Rajaeian S., Ehsanpour , and Toghyani MA. 2015. Changes in phenolic compound, TAL, PAL activity of Nicotiana rustica triggered by ethanolamine pretreatment under in vitro salt stress condition. Iranian Journal of Plant Biology 7(26): 1-12. (In Persian with English abstract)
25
Rawat L., Singh Y., Shukla N., and Kumar J. 2011. Alleviation of the adverse effects of salinity stress in wheat (Triticum aestivum) by seed biopriming with salinity tolerant isolates of Trichoderma harzianum. Plant and Soil 1-2: 347-387.
26
Rivero ST., Moorillon VN., and Borunda EO. 2009. Growth, yield, and nutrient status of pecans fertilized with biosolids and inoculated with rizosphere fungi. Bioresource Technology 100(6): 1992-1998.
27
Saini S. 2016. Trichoderma and metal chelator enhanced growth and yields in wheat plants by increasing zinc availability. International Education and Research 2(1): 375-390.
28
Samuels GJ., Ismaiel A., Mulaw TB., Szakacs G., and Druzhinina IS. 2012. The Longibrachiatum clade of Trichoderma: a revision with new species. Fungal Diversity 55(1): 77-108.
29
Scott, JD. 1976. Praise the Potato. Reader’s Digest Dec, 205-212.
30
Sharma P., Patel AN., Saini MK., and Deep S. 2012. Field demonstration of Trichoderma harzianum as a plant growth promoter in wheat (Triticum aestivum). Journal of Agricultural Science 4(8): 65-77.
31
Shoresh M., Harman GE., and Mastouri F. 2010. Induced systemic resistance and plant responses to fungal biocontrol agents. Annual Review of Phytopathology 48: 21-43.
32
Singh A., Shahid M., Srivastava M., Pandey S., Sharma A., and Kumar V. 2013. Optimal physical parameters for growth of Trichoderma species at varying ph, temperature and agitation. Virology and Mycology 3: 2161-0517.
33
Surekha C., Neelapu N., Prasad BS., and Ganesh PS. 2014. Induction of defense enzymes and phenolic content by Trichoderma viride in Vigna mungo infested with Fusarium oxysporum and Alternaria alternata. International Journal Agric Sci Research 4(4): 31-40.
34
Woudenberg JHC., Groenewald JZ., Binder M., and Crous PW. 2013. Alternaria Studies in Mycology 75:171-212.
35
Yasin M., Munir I., and Faisal M. 2016. Can Bacillus enhance K+ uptake in crop species Potassium solubilizing microorganisms for sustainable agriculture. Springer, New Delhi. 163-170.
36
ORIGINAL_ARTICLE
Evaluation of a Botanical Acaricide Contain Cottonseed and Clove Oils against Two-spotted Spider Mite in Apple Orchards of Iran
Introduction: One of the major pests of apple trees all-around of Iran is two-spotted spider mites (TSM, Tetranychus urticae Koch (1836)). This pest reported from Gorgan and Mazandaran areas for the first time. This cosmopolitan mite is reported in almost all parts of the country and found in all countries of the world on more than 150 economic plant species. This pest has been causing damage to the farmer in various apple orchards in the country every year. Because of high rate of fecundity, high population density, short life cycle and develop resistance to pesticides, TSM is an invasive pest on apple trees and difficult to control. Also, due to the continued use of various broad-spectrum chemical insecticides / Acaricides to controlling this pest, in addition to making the potential of resistance, it has also eliminated natural enemies. Up to date no botanical acaricides has been registered on TSM in apple orchards of Iran. Accordingly, Pestout® as a botanical acaricide to control the active stages of TSM at two concentrations and in comparison to spirodiclofen and fenazaquin were evaluated in three provinces of Tehran, Isfahan and Khorasan Razavi in 2018.
Materials and Methods: During 2018, Pestout® contain cottonseed and clove oils as a botanical acaricide to control the active stages of TSM at concentrations of 3 and 5 ml/l and in comparison of spirodiclofen SC 24% (Envidor®) 0.5 ml/l, fenazaquin SC 20% (Pride®) 0.5 ml/l and control (spraying) were evaluated in three provinces of Tehran, Isfahan and Khorasan Razavi in 2018. The experiment was carried out in a randomized complete block design with three replications (each replicate containing two trees variety yellow with the same conditions) for each treatment. Sampling was taken 1 day before and after spraying, at 3, 7 and 14 days’ intervals from 40 leaves of each experimental unit. Then the immature and female adults of spider mites in the leaves were counted and registered by using binocular in Agricultural Zoology Research Laboratory of the Iranian research institute of plant protection and also in Isfahan and Khorasan Razavi provinces. Data obtained from sampling were corrected by Henderson-Tilton formula. The normality of the data was evaluated using SAS software and Kolmogorov-Smirnov test. After analysis of variance using one-way ANOVA in SAS software mean comparison was performed by Duncan’s multiple range test in SAS 9.4 software.
Results and Discussion: The analysis of variance showed that there was a significant difference between all treatments with control in three provinces across all days. Based on the results obtained in Tehran province, both concentrations of Pestout (With more than 82% mortality) besides of Envidor (with more than 86% mortality) were most efficient in all days after spraying. In Isfahan province, the efficacy of Pestout in both concentrations were in the same group with Envidor and Pride. On the other hand, no significant differences were observed between the abovementioned treatments in all days. In fact, for all four treatments acceptable performance recorded. In this province, the mean mortality of 3 ml/l Pestout varied between 74% to 80% during the test days and for concentrations 5 ml/l were 77% to 82%. In Khorasan Razavi province, the efficacy of Pestout 5 ml/l on 3, 7 and 14 days after treatment were more than 92%, 94% and 89% mortality, respectively. Also, mean mortality at concentrations 3 ml/l were recorded 84.70%, 89.91% and 82.16%, respectively. Therefore, both concentrations in this province had a good efficacy.
Conclusion: Poor orchard management and the effects of climate change, are increasing pest problems, including TSM incidence, in Iranian orchards. Increased chemical pesticide use is leading to greater occurrence of pest resistance, insufficient control and increased production costs are some of the problems. The registration and implementation of low risk and effective botanical pesticides are one of the best methods for solving the problem and make a great IPM program in the orchards. Therefore, in the present study, it can be concluded that Pestout is a good candidate for controlling the two-spotted spider mite on apple trees, and the concentration 3 ml/l of this compound is recommendable in Iran.
https://jpp.um.ac.ir/article_40740_eced753de2ff44c34e31ffd9411f1e4b.pdf
2022-01-21
445
455
10.22067/jpp.2021.32703.0
Apple
Botanical acaricide
Pestout
two-spotted spider mite
M.
Mirzaei
m.mirzaie63@gmail.com
1
Assistant Professor, Agricultural Zoology Research Department, Iranian Research Institute of Plant Protection, Agricultural Research, Education and Extension Organization (AREEO), Tehran, Iran
LEAD_AUTHOR
mohammad rerza
nemato allahi
mr_nematollahi@yahoo.com
2
رکز تحقیقات کشاورزی و منابع طبیعی استان اصفهان
AUTHOR
H.
Kamali
hashemkamali@gmail.com
3
Associate Professor, Plant protection research department, Khorasan Razavi Agricultural and Natural Resources Research and Education Center, AREEO, Khorasan Razavi, Iran
AUTHOR
Ahmadi K., Gholizadeh H., Ebadzadeh H.R., Hossinpour R., Hatami F., Abdeshah H., Rezaei M.M., Kazemifard R., and Fazliestabragh M. 2017. Agricultural Statistics - Volume Three Horticultural Products. Ministry of Jihad-e Agriculture, Ministry of Jihad-e-Agriculture, Deputy of Planning and Economics, ICT Center. Tehran.
1
Ashrafju M., Ahmadi K., Taklloozadeh H.M., Baniadami Y., and Nazarian A. 2011. Effect of ethanolic extract of Melia azedarach seeds on oviposition and egg hatching of Tetranychus urticae (Acari: Tetranychidae). Journal of Herbal Drugs 2(3):165-169. (In Persian with English abstract)
2
Attia S., Grissa K.L., Lognay G., Bitume E., Hance T., and Mailleux A.C. 2013. A review of the major biological approaches to control the worldwide pest Tetranychus urticae (Acari: Tetranychidae) with special reference to natural pesticides. Journal of Pest Science 86(3): 361-386.
3
Attia S., Grissa K.L., Lognay G., Heuskin S., Mailleux A. C., and Hance T. 2011. Chemical composition and acaricidal properties of Deverra scoparia essential oil (Araliales: Apiaceae) and blends of its major constituents against Tetranychus urticae (Acari: Tetranychidae). Journal of Economic Entomology 104(4): 1220-1228.
4
Attia S., Grissa K.L., Mailleux A.C., Lognay G., Heuskin S., Mayoufi S., and Hance T. 2012. Effective concentrations of garlic distillate (Allium sativum) for the control of Tetranychus urticae (Tetranychidae). Journal of Applied Entomology 136(4): 302-312.
5
Azizian N., Moayeri H.S., Kavousi O., and Bolandnazar A. 2013. Contact Toxicity of Some Formulated Herbal Composition on Two Spotted Spider Mite. Journal of Plant Protection 28(3): 393-399. (In Persian with English abstract)
6
Campos E.V., Proença P.L., Oliveira J.L., Melville C.C., Della Vechia J.F., De Andrade D.J., and Fraceto L.F. 2018. Chitosan nanoparticles functionalized with β-cyclodextrin: a promising carrier for botanical pesticides. Scientific Reports 8(1): 2067.
7
Chiasson H., Bostanian N.J., and Vincent C. 2004. Acaricidal properties of a Chenopodium-based botanical. Journal of Economic Entomology 97: 1373-1377.
8
Cloyd R.A., Galle C.L., Keith S.R., Kalscheur N.A., and Kemp K.E. 2009. Effect of commercially available plant-derived essential oil products on arthropod pests. Journal of Economic Entomology 102(4): 1567-1579.
9
de Oliveira J.L., Campos E.V., Germano‐Costa T., Lima R., Vechia J.F.D., Soares S.T., ... and Fraceto L.F. 2019. Association of zein nanoparticles with botanical compounds for effective pest control systems. Pest Management Science 75(7): 1855-1865.
10
Dubey N.K., Shukla R., Kumar A., Singh P., and Prakash B. 2010. Prospects of botanical pesticides in sustainable agriculture. Current Science 98(4): 479-480.
11
Erdogan P., Yildirim A., and Sever B. 2012. Investigations on the effects of five different plant extracts on the two-spotted mite Tetranychus urticae Koch (Arachnida: Tetranychidae). Psyche: A Journal of Entomology 2012: 1-5.
12
Gilrein D. 2002. Control of two spotted spider Mite on with ovation and unconventional new miticides, Cornell Cooperative IIxtension of Suffolk country Long Island Horticultural Research and Extension Center Riverhead, NewYork.
13
Hariri M.F. and Moharramipour S. 2012. Ovicidal activity of essential oils from two species of Eucalyptus on two spotted spider mite, Tetranychus urticae Plant Protection 35(2): 13-25. (In Persian with English abstract)
14
Hector A., and Bagchi R. 2007. Biodiversity and ecosystem multifunctionality. Nature 448: 188-190.
15
Henderson C.F., and Tilton E.W. 1955. Tests with acaricides against the brown wheat mite. Journal of Economic Entomology 48(2): 157-161.
16
Heuskin S., Verheggen F.J., Haubruge E., Wathelet J.P., and Lognay G. 2011. The use of semiochemical slow-release devices in integrated pest management strategies. Biotechnologie, Agronomie, Société et Environnement 15(3): 459-470.
17
Huffaker C., Van de Vrie M., and McMurtry J. 1970. Ecology of tetranychid mites and their natural enemies: A review: II. Tetranychid populations and their possible control by predators: An evaluation. California Agriculture 40(11): 391-458.
18
Isman M.B. 2004. Plant essential oils as green pesticides for pest and disease management. ACS Symp Ser, 887: 41-51.
19
Jacobson M. 1989. Botanical pesticides: past, present and future. Insecticides of Plant Origin 387: 1-10.
20
Johnson W.T., and Lyon H.H. 1991. Insects That Feed on Trees and Shrubs (2nd), New York.
21
Kolyaee A., Rezvani A., and Kamali H. 2012. Pests of fruit crops in Iran. Ministry of Jihad-e Agriculture, Agricultural Research Education and Extension Organization, Iranian research Institute of Plant Protection, Tehran.
22
Kumral N.A., Çobanoğlu S., and Yalcin C. 2010. Acaricidal, repellent and oviposition deterrent activities of Datura stramonium against adult Tetranychus urticae (Koch). Journal of Pest Science 83(2): 173-180.
23
Mansour F., Ravid U., and Putievsky E. 1986. Studies of the effects of essential oils isolated from 14 species of Labiatae on the carmine spider mite, Tetranychus cinnabarinus. Phytoparasitica 14(2): 137-142. (In Persian with English abstract)
24
McMurtry J., Huffaker C., and Van de Vrie M. 1970. Ecology of tetranychid mites and their natural enemies: A review: I. Tetranychid enemies: Their biological characters and the impact of spray practices. California Agriculture 40(11): 331-390.
25
Migeon A., Nouguier E., and Dorkeld F. 2011. Spider Mites Web: a comprehensive database for the Tetranychidae. In Trends in Acarology (pp. 557-560). Springer Netherlands.
26
Mirzaei M., Nematollahi M.R., and Golmohammadi G. 2020. Evaluating currently used pesticides in apple orchards on field populations of Tetranychus urticae Koch (Acari: Tetranychidae). Archives of Phytopathology and Plant Protection 53: 1-11.
27
Moayeri H.R.S., and Pirayeshfar F. 2014. Acaricidal effects of shirazi thyme, galbanum and savory essential oils on two-spotted spider mite, Tetranychus urticae Koch (Acari: Tetranychidae). Iranian Journal of Medicinal and Aromatic Plants 3(5): 771-779. (In Persian with English abstract)
28
Moayeri H.R.S., Pirayeshfar F., Azizian N., and Bolandnazar A.R. 2015. Acaricidal effect of some formulated compositions based on cinabery extract and herbal essential oils on the two-spotted spider mite (Tetranychus urticae). Iranian Journal of Medicinal and Aromatic Plants 31(1): 102-114. (In Persian with English abstract)
29
Moin Aldini S.A., Zand E., Kambozia J., Mahdavi Damghani A., and Deihim Fard R. 2014. Environmental hazard assessment by using insecticides registered in Iran with the EIQ index. Journal of Agroecology 6(2): 250-265. (In Persian with English abstract)
30
Mousa G.M., and El-Sisi A.G. 2001. Evaluating of some local alternatives: mineral oils, plant materials and surfactant against piercing and sucking pests infesting squash crops. In 1. Conference on Safe Alternatives of Pesticides for Pest Management, Assiut (Egypt), 28-29 Oct 2001.
31
Muayeri H.R.S., Pirayeshfar F., and Kavousi O. 2013. Repellency effect of three herbal essential oils on the two-spotted spider mite, Tetranychus urticae. Iranian Journal of Plant Protection Science 44(1): 103-112. (In Persian with English abstract)
32
Nauen R., Stumpf N., Elbert A., Zebitz C.P.W., and Kraus W. 2001. Acaricide toxicity and resistance in larvae of different strains of Tetranychus urticae and Panonychus ulmi (Acari: Tetranychidae). Pest Management Science 57(3): 253-261.
33
PaVela R. 2009. Effectiveness of some botanical insecticides against Spodoptera littoralis Boisduvala (Lepidoptera: Noctudiae), Myzus persicae Sulzer (Hemiptera: Aphididae) and Tetranychus urticae Koch (Acari: Tetranychidae). Plant Protection Science 45(4): 161-167.
34
Regnault-Roger C., Vincent C., and Arnason J.T. 2012. Essential oils in insect control: low-risk products in a high-stakes world. Annual Review of Entomology 57: 405-424.
35
Rock G., and Crabtree K.W. 1987. Biological activity of petroleum and cottonseed oils against two Tetranychid mite species and two tortricid insect species found on apple. Journal Agricultural Entomology 4: 247-253.
36
Seifi R., Moharramipour S., and Ayyari M. 2018. Acaricidal activity of different fractions of Moringa peregrina on two spotted spider mite Tetranychus urticae (Acari: Tetranychidae). Industrial Crops and Products 125: 616-621. (In Persian with English abstract)
37
Shi G.L., Zhao L.L., Liu S.Q., Cao H., Clarke S.R., and Sun J.H. 2006. Acaricidal activities of extracts of Kochia scoparia against Tetranychus urticae, Tetranychus cinnabarinus, and Tetranychus viennensis (Acari: Tetranychidae). Journal of Economic Entomology 99(3): 858-863.
38
Steiner M.Y., Spohr L.J. and Goodwin S. 2011. Impact of two formulations of the acaricide bifenazate on the spider mite predator Phytoseiulus persimilis Athias-Henriot (Acari: Phytoseiidae). Aust Journal Entomology 50: 99-105.
39
Tirello P., Pozzebon A. and Duso C. 2012. Resistance to chlorpyriphos in the predatory mite Kampimodromus aberrans. Experimental Applied Acarology 56: 1-8.
40
Van de Vrie M., McMurtry J., and Huffaker C. 1972. Ecology of tetranychid mites and their natural enemies: A review: III. Biology, ecology, and pest status, and host-plant relations of tetranychids. California Agriculture 41(13): 343-432.
41
Van Leeuwen T., Vontas J., Tsagkarakou A., and Tirry L. 2009. Mechanisms of acaricide resistance in the two-spotted spider mite Tetranychus urticae. In Biorational control of arthropod pests (pp. 347-393). Springer Netherlands.
42
Ziaee M., Nikpay A., Koohzad-Mohammadi P., and Behnam-Oskuyee S. 2017. The toxicity of Biomite®, GC-mite®, Oberon® and Envidor® acaricides against sugarcane yellow mite, Oligonychus sacchari (Acari: Tetranychidae). Persian Journal of Acarology 6(2): 137-141. (In Persian with English abstract)
43
ORIGINAL_ARTICLE
Use of Microsatellite Markers for Analysis of Genetic Diversity between Populations of Green Lacewings Chrysoperla carnea (Neuroptera, Chrysopidae)
Introduction: Green lacewings are active predators of Aphids, Psylids, Mealy bugs. We used ISSR markers with 10 primers to evaluate the genetic polymorphism between populations of Chrysoperla carnea collected in 30 cities of 14 provinces of Iran with different climatic conditions and compared them with specimens of a population from Netherlands. Maximum and minimum of polymorphism were calculated successively of 88.88% for UBC-809 and 33.33% for UBC-886 primers. The Dutch specimens had the smallest genetic distance with populations of Guilan province and the largest genetic distance to Kerman province. The mean number of alleles for Dutch, Guilan and Kerman populations were successively 6.9, 6.6 and 4.1 and mean number of effective alleles were successively 1.48, 1.41 and 1.19.
Materials and Methods: 2000 specimens of Chrysoperla carnea collected from alfa alfa plantations in each of 14 provinces of Iran, 27 specimens sampled from each province besides another 27 specimens of a Dutch population acquired from Hamedan center for Science and technology and DNA extracted using Topaz Inc. kit , ISSR marker with 10 primers used. BioRad® thermocycler was used for PCR and PCR end product was electrophoresed in 2% Agarose gel and stained with ethidium bromide. Bands photographed using Gel Doc 2000. Hardy-weinberg’s chi square ( χ2) equation was used for evaluate of equilibrium in the number of polymorphic alleles,Shannon and Nei indice for evaluation of heterozygosity, POPGENE for genetic distance , GenAlex 6 for cluster analysis, AMOVA for analysis of inter and intra populations diversity.
Results and Discussion: The total number of electrophoresis bands were 64 bands, 43 of them were polymorphic The range of changes of allelic sizes of primers were between 150-1500 bp. Polymorphic information content(PIC) was between 0.302-0.643 the maximum of it belonged to the primerUBC-809 and the minimum belonged to the primer UBC-812 (Table 3). In three populations of Dutch, Guilan and Kerman the maximum of alleles were seen in gene locus of UBC-809 suggesting that it is highly polymorphic, similar findings was found by Barbosa and co-workers. As in Fig (2) the cluster analysis based on use of Jaccard similarity coefficient, the populations clustered in three groups, the Dutch population together with those of Guilan, Mazendaran, Lorestan, East and west Azerbaijan provinces were gathered in the first cluster and populations of Kerman, Sistan and Beluchestan, Isfahan and Fars province were gathered in the second cluster and the populations of Hamedan, Zanjan, Kermanshah, Tehran and Kudistan provinces were in the third cluster. Principal Component analysis was also done, Eigen values, variances percentage and cumulative variances percentages by independent components and the range of variations represented by these components was shown in Table (5). 100% of variations were represented by first ten independent components. The first, second and third components successively represented 27.68,20.57 and 13.01 percentages of all variations.These components independently from each other represented a percent of genetic diversity, not already known. The maximum of Shannon index was seen in gene locus of UBC-809was 0.53 in Guilan province and the minimum 0.04 in Kerman province.These data were conceivable because there were nine alleles in gene locus of UBC-809 in population of Guilan province and two alleles in gene locus of UBC-812 in populations of Kerman province, the same index was calculated 0.58 for Dutch population. The maximum and the minimum of Nei’s index (H) of gene diversity was calculated 0.35for gene locus of UBC-809 in Guilan province and 0.009 for gene locus of UBC-812 in Kerman province successively and for Dutch population the index was 0.39. The maximum and minimum of observed heterozygosity (Ho) was 0.49 in gene locus of UBC-809 in Guilan and 0.031 in gene locus of UBC-812 in Kerman province successively. The maximum and minimum of expected heterozygosity was calculated as 0.579 in gene locus of UBC-809 in Mazendaran province and 0.034 in gene locus of UBC-886 in Hormozgan province successively. Having nine alleles in its gene locus and getting of maximum observed and expected heterozygosity therefore we can consider the UBC-809 primer as the best gene locus to express of gene diversity in all Chrysoperla carnea populations studied in our present study. We used χ2 of Hardy-Weinberg equilibrium for all alleles studied, and with regard to H0(Equilibrium in alleles frequency in studied populations) the most well adapted status to Hardy-weinberg equilibrium was seen in gene loci of UBC-809, some of populations and gene loci did have Hardy-Weinberg equilibrium but others did have significant biases from this equilibrium which should be attributed to inadequate number of samples chosen (sampling errors) in the studied populations and or existence of non-reproducing alleles. Our study on population genetic diversity of Chrysoperla carnea showed that ISSR-PCR markers are the best to study the polymorphism of populations of this species, did not study hitherto in Iran.The primers used by us in this study for Chrysoperla carnea was equally used for other orders of insects such as Lepidoptera and Coleoptera (UBC-809) and used for order of Hemiptera (UBC-812, UBC-819).
Conclusion: More genetic diversity of alleles in populations of Chrysoperla carnea collected from non-treated alfa alfa plantations than those treated with insecticides. Similar results was obtained in Brazil concerning populations of Chrysoperla externa. Our present study on Chrysoperla carnea in Iran showed us the similarity between gene frequencies in the studied provinces, similar results was found for other species of Chrysoperla. Some authors believe that reduction in heterozygotes alleles in population was caused by a reduction in effective number of alleles in that population. The decrease of allele's diversity could bring about a reduction of populations, even species, as well as the reproduction vigor of populations in a new environment. In insect breeding programs a reduction in genetic diversity has an impact of reduction of fitness or even the loss of fitness in such an environment in which those populations should be released. We propose that our research on heterozygosity of populations of Chrysoperla carnea to be continued in more agroecosystems in Iran with a similar or different molecular markers to have more informations about populations genetic diversity and finally to consider a logical management for preserving genetic reservoirs of them.
https://jpp.um.ac.ir/article_40617_f6558ebd3093f9ff23273edebb562658.pdf
2022-01-21
457
468
10.22067/jpp.2021.67819.1001
Chrysoperla carnea
ISSR primers
geographical populations
Genetic diversity
F.
Abdolahadi
1
Department Plant Protection, Campus of Agriculture and Natural Resources Razi University, Kermanshah, Iran
AUTHOR
A.
Mirmoayedi
alimirmoayedi@gmail.com
2
Professor of Entomology Razi university, Kermanshah, Iran.
LEAD_AUTHOR
S.
Jamali
s.jamali@razi.ac.ir
3
Department Plant Protection, Campus of Agriculture and Natural Resources Razi University, Kermanshah, Iran
AUTHOR
L.
Zarei
4
Department Plant Production and Genetic Engineering, Campus of Agriculture and Natural Resources Razi University, Kermanshah, Iran
AUTHOR
1-Abbot P. 2001. Individual and population variation in invertebrates revealed by Inter-simple Sequence Repeats (ISSR). Journal of Insect Science 1(1): 1-8.
1
2-Andrews C.A. 2010.Natural Selection, Genetic Drift, and Gene Flow Do Not Act in Isolation in Natural Population Nature Education Knowledge 3 (10):5, Available at https://www.nature .com/scitable/knowledge/library/natural-selection-genetic-drift-and-gene-flow-15186648/#(visited 15.December2020).
2
3-Barbosa N.C., Freitas S.D., and Morales A.C. 2014. Distinct genetic structure in populations of Chrysoperla externa (Hagen)(Neuroptera, Chrysopidae) shown by genetic markers ISSR and COI gene. Revista Brasileira de Entomologia 58(2): 203-211.
3
4-Borba R.D.S., Garcia M.S., Kovaleski A., Oliveira A.C., Zimmer P.D., Castelo Branco J.S., and Malone G. 2005. Genetic dissimilarity of lines of Trichogramma Westwood (Hymenoptera: Trichogrammatidae) through ISSR markers Neotropical Entomology 34(4): 565-569.
4
5-Canard M., McEwen P., New T., and Whittington A. 2001. Natural food and feeding habits of lacewings. Lacewings in the Crop Environment 1: 116-129.
5
6- Chatterjee SN., and Mohandas T.P. 2003. Identification of ISSR markers associated with productivity traits in silkworm, Bombyx moni L, 46(3): 438-47.
6
7- Costa R.I., Souza B., and de Freitas S. 2010. Spatio-Temporal Dynamic of Green Lacewings (Neuroptera: Chrysopidae) Taxocenosis on Natural Ecossystems. Neotropical Entomology 39(4): 470-475.
7
8- Duran C., Appleby N., Edwards D., and Batley J. 2009. Molecular genetic markers: discovery, applications, data storage and visualisation. Current Bioinformatics 4(1): 16-27.
8
9- Fumagalli L., Snoj A., Jesenšek D., Balloux F., Jug T., Duron O., Brossier F., Crivelli A.J., and Berrebi, P. 2002. Extreme genetic differentiation among the remnant populations of marble trout (Salmo marmoratus) in Slovenia. Molecular Ecology 11(12): 2711-2716.
9
10- Huala L., Paredes M., Salazar L., Elgueta M., and Rebolled R. 2018. Genetic variability in Aegorhinus superciliosus (Coleoptera: Curculionidae) populations in Chilean Maytenus boaria (Celastrales: Celastraceae). Revista Colombiana de Entomología 44(2): 260-265
10
11- Hufbauer R.A., and Roderick G.K. 2005. Microevolution in biological control: mechanisms, patterns, and processes. Biological Control 35(3): 227-239.
11
12- Hundsdoerfer A.K., and Wink M. 2009.Experimental population genetics in insects: inheritance of ISSR-PCR bands in an artificial population. Zootaxa 2231(1): 40–46.
12
13- Khidr S.K., Hardy I.C., Zaviezo T., and Mayes S. 2014. Development of microsatellite markers and detection of genetic variation between Goniozus wasp populations. Journal of insect science (Online), 14, 43. Available at https://doi.org/10.1093/jis/14.1.43 (visited 8.December 2020).
13
14- Lourenço P., Brito C., Backeljau T., Thierry D., and Ventura M. 2006. Molecular systematics of the Chrysoperla carnea group (Neuroptera: Chrysopidae) in Europe. Journal of Zoological Systematics and Evolutionary Research 44(2): 180-184.
14
15- Luque C., Legal L., Staudter H., Gers C., and Wink M. 2002. ISSR (inter simple sequence repeats) as genetic markers in Noctuids (Lepidoptera). Hereditas 136(3): 251-253.
15
16- McEwen P., New T., and Whittington A.E. 2001. Lacewings in the crop environment. Cambridge university press.
16
17- Miller N., Birley A., Overall A., and Tatchell G. 2003. Population genetic structure of the lettuce root aphid, Pemphigus bursarius (L.), in relation to geographic distance, gene flow and host plant usage. Heredity 91(3): 217-223.
17
18- Mirmoayedi A. 2002. New records of Neuroptera from Iran. Acta Zoologica Academiae Scientiarum Hungaricae, 48: 197-201.
18
19- Mirmoayedi A., Rashidikhah F., Kahrizi D., Yari K. 2018. Genetic relationship between neuropteran families (Insecta, Neuropterida, Neuroptera) based on cytochrome oxidase sequences.- Genetika 50(2): 717-730.
19
20- Morales A.C and Freitas S .2010. Haplotype characterization of the COI mitochondrial gene in Chrysoperla externa ( Neuroptera: Chrysopidae) from different environments in Jaboticabal, state of São Paulo, southeastern Brazil. Brazilian Journal of Biology 70(4): 1115-1121.
20
21- Morales A., Lavagnini T., and Freitas S. 2013. Loss of genetic variability induced by agroecosystems: Chrysoperla externa (Hagen)(Neuroptera: Chrysopidae) as a case study. Neotropical Entomology 42(1): 32-38.
21
22- Nei M. 1972. Genetic distance between populations. The American Naturalist 106(949): 283-292.
22
23- Pappas M., Broufas G., and Koveos D. 2011. Chrysopid predators and their role in biological control. Journal of Entomology 8(3): 301-326.
23
24- Peakall R., and Smouse P.E. 2006. Genalex 6: Genetic analysis in Excel. Population genetic software for teaching and research. Molecular Ecology Notes 6(1): 288-295.
24
25- Rahimi A., Miromayedi A., Kahrizi D., Abdolshahi R., Kazemi E., and Yari KH. 2014. Microsatellite genetic diversity of Apis mellifera meda skorikov. Molecular Biology Reports 41: 7755–7761.
25
26- Rahimi A., Mirmoayedi A., Kahrizi D., Zarei L., and Jamali S. 2016.Genetic diversity of Iranian honey bee (Apis mellifera meda Skorikow, 1829) populations based on ISSR markers. Rahimi et al. Cellular and Molecular Biology 62(4): 53-58.
26
27- Reed D.H., Lowe E.H., Briscoe D.A., and Frankham R. 2003. Fitness and adaptation in a novel environment: effect of inbreeding, prior environment, and lineage. Evolution 57(8): 1822-1828.
27
28- Roux O., Gevrey M., Arvanitakis L., Gers C., Bordat D., and Legal L. 2007. ISSR-PCR: Tool for discrimination and genetic structure analysis of Plutella xylostella populations native to different geographical areas. Molecular Phylogenetics and Evolution 43(1): 240-250.
28
29- Royan M., Rahimi G., Esmaeilkhanian S., Mirhoseini S., and Ansari Z. 2007. A study on the genetic diversity of the Apis mellifera meda population in the south coast of the Caspian Sea using microsatellite markers. Journal of Apicultural Research 46(4): 236-241.
29
30- Saha D., Ranjan S.K., Mallick C.B.,Vidyarthi A.S., and Ramani R. 2011. Genetic diversity in lac resin-secreting insects belonging to Kerria spp., as revealed through ISSR markers. Biochemical Systematics and Ecology 39(2): 112-120.
30
31- Souza G.A.D., Carvalho M.R.D.O., Martins E.R., Guedes R.N.C., and Oliveira L.O.D. 2008. Genetic diversity estimated through ISSR markers in populations of Zabrotes subfasciatus. Pesquisa Agropecuária Brasileira 43(7): 843-849.
31
32- Taylor S., Downie D., and Paterson I. 2011. Genetic diversity of introduced populations of the water hyacinth biological control agent Eccritotarsus catarinensis (Hemiptera: Miridae). Biological Control 58(3): 330-336.
32
33- Vaulin O., Zharikov T.Y., Gunderina L., and Zakharov I. 2006. Variability and differentiation of genomic DNA in the Drosophila melanogaster populations of Russia and Ukraine. Drosophila Information Service 89: 59-62.
33
34- Vianna M.F., Pelizza S., Russo M.L., Toledo A., Mourelos C., and Scorsetti A.C. 2020.ISSR markers to explore entomopathogenic fungi genetic diversity: Implications for biological control of tobacco pests. Journal of Biosciences 45, 136. Available at https://doi.org/10.1007/s12038-020-00108-4 (visited 7. December 2020)
34
35- Wells M.M. 1994. Small genetic distances among populations of green lacewings of the genus Chrysoperla (Neuroptera: Chrysopidae). Annals of the Entomological Society of America 87(6): 737-744.
35
36- Yeh F.C. 1999. POPGENE (version 1.3. 1). Microsoft Window-Bases Freeware for Population Genetic Analysis.Available at http://www. ualberta. ca/~ fyeh/.(visited 7.December 2020)
36
ORIGINAL_ARTICLE
Effect of Different Organic and Chemical Compounds on Population Density of Trialeurodes vaporariorum Westwood and Some Secondary Metabolites of Bean Plant
Introduction: Greenhouse whitefly, Trialeurodes vaporariorum Westwood (Hemiptera: Aleyrodidae), is a serious pest of a wide range of plants, such as common bean, cucumber, tomato, pepper, lettuce, etc, in both field and greenhouse production. It typically feeds on the underside of leaves, sucking phloem sap from the plant, which causes both direct damage, by overall weakening the plant and reducing yield, and indirect damage, by excreting honeydew, on which sooty mold grows, as well as transmission of several plant viruses. The widespread use of insecticides to control T. vaporariorum has resulted in developing resistance to the insecticides and affected human’s health and safety. The utilization of plant extract and elicitors is an environmentally safe method that is used in the control recently. Therefore, alternative control strategies are required to minimize the harmful effects of insecticides. In order to control this pest, environmentally friendly methods, especially of plant origin are recently considered by researchers. For this regard, the effect of some organic compounds including methanolic and n-hexanic extract of walnut’s husk or dill’s seeds and salicylic acid, individually and in combination with spirotetramat on population density of greenhouse whitefly’s nymphs and some secondary compounds of bean plant were investigated.
Materials and Methods: Seeds of common bean, Phaseolus vulgaris L. (Berloty cultivar) were sown and grown in 15-cm-plastic pots in a greenhouse at 25 ± 3°C, 50 ± 10% RH, and a natural photoperiod. For the experiments, potted bean plants at 6-8 leaf stage, highly infested with T. vaporariorum nymphs, were sprayed with 12 different treatments, including: (1) spirotetramat (SP), (2) methanolic extract of walnut husk (MW), (3) n-hexanic extract of walnut husk (NW), (4) methanolic extract of dill seed (MD), (5) n-hexanic extract of dill seed (ND, (6) salicylic acid (SA), (7) spirotetramat in combination with salicylic acid (SP+SA), (8) spirotetramat in combination with methanolic extract of dill seed (SP+MD), (9) spirotetramat in combination with methanolic extract of walnut husk (SP+MW), (10) spirotetramat in combination with n-hexanic extract of dill seed (SP+ND), (11) spirotetramat in combination with n-hexanic extract of walnut husk (SP+NW), and (12) water as a control (CO). After five days, the population density of T. vaporariorum nymphs on bean plants leaves was recorded. Furthermore, the effects of tested treatments on the total phenol and flavonoid contents of bean plants were evaluated. For this reason, dried leaves (5 g) from each treatment were used for the preparation of extracts. The total phenolic of the extracts were determined using the Folin - Ciocalteu reagent. Sample and standard readings were made using a spectrophotometer (Lambda 45-UV/Visible) at 765 nm against the reagent blank. Furthermore, the aluminum chloride colorimetric method was used for determination of the total flavonoid content of treatments. For total flavonoid determination, quercetin was used to make the standard calibration curve. The absorbance was read using a spectrophotometer (Lambda 45-UV/Visible) in the wavelengths of 415 nm. Data were analyzed by one-way ANOVA using SPSS 23.0 software. Comparison of means for nymph density using SNK (Student-Newman-Keuls) multi-range test and comparison of means for secondary chemical compositions using Tukey's test at probability level five Percentage occurred.
Results and Discussion: Results showed that the population density of greenhouse whitefly and the secondary metabolites of plant were significantly affected by the tested treatments. The lowest number of whitefly’s nymphs was on spirotetramat and spirotetramat in combination with methanolic extract of dill seed and the highest number was on control. Total phenolic contents ranged from 58.96 to 114.07 mg g-1 dry weight on different treatments, which the highest and lowest amount of it was obtained in spirotetramat in combination with methanolic extract of dill seed and spirotetramat in combination with n-hexanic extract of walnut husk, respectively. The highest amount of total flavonoid content of bean plants was in spirotetramat in combination with salicylic acid. The results of the present study showed that the density of greenhouse whitefly population in spirotetramate treatment was lower than other treatments but there was no significant difference with the combined treatments and methanolic extract of walnut husk. Also, all the treatments compared to the control significantly changed the population density of this pest and increased the amount of total phenolic compound in bean plant. Therefore, these compounds, especially the methanolic extract of walnut husk, can be used in integrated management programs of this pest.
Conclusion: This research could provide valuable information for control of T. vaporariorum in other plants like ornamental plants in the field and greenhouse and thus can be useful for the production of healthy and organic crops. So it can be used in the IPM programs of this pest.
https://jpp.um.ac.ir/article_40352_ee8b45d411461ae6edef8fe3fabe41ee.pdf
2022-01-21
469
480
10.22067/jpp.2021.68750.1009
salicylic acid
Plant extract
total flavonoid
Total phenol
Whitefly
M.
Karamoozian
mohammadkaramozian69@gmail.com
1
in Department of Plant Protection, Faculty of Agriculture, Shahid Bahonar University, Kerman, Iran
AUTHOR
M.
Pahlavan Yali
mrmpahlavan@gmail.com
2
in Department of Plant Protection, Faculty of Agriculture, Shahid Bahonar University, Kerman, Iran
LEAD_AUTHOR
K.
Ahmadi
kahmadi@uk.ac.ir
3
Department of Plant Protection, Faculty of Agriculture, Shahid Bahonar University, Kerman, Iran
AUTHOR
Agrawal A.A., and Karban R. 1999. Why induced defenses may be favored over constitutive strategies in plants. In: Tollrian, R. and Harvell, C.D. (eds) The ecology and evolution of inducible defenses. Princeton University press, Princeton, NJ., pp. 45-61.
1
Al-HakimiN. 2008. Effect of salicylic acid on biochemical changes in wheat plants under khat leaves residue. Plant Soil and Environment 54: 288-293.
2
Asha K., Sucheta G., Kavita M., Nirmala , and Jyoti S. 2010. Quantification of phenolics and flavonoids by spectrophotometer from Juglans regia. International Journal of Pharma and Bio Sciences 3: 1-4.
3
Babri R.A., Khokhar I., Mahmood Z. and Mahmud S. 2012. Chemical composition and insecticidal activity of the essential oil of Anethum graveolens Science International (Lahore) 24: 453-455.
4
Bakr A.A., Rezk H.A., Saleh S.M., and El-Morshedy N.H. 2020. Significance of foliar sprayed salicylic acid in kidney bean resistance against Tetranychus urticae (Trombidiformes: Tetranychidae) attack. Persian Journal of Acarology 9: 193-205.
5
Buttery R.G., Flath R.A., Mon T.R., and Ling L.C. 1986. Identification of Germacrene D in walnut husk and fig leaf volatiles. Journal of Agricultural and Food Chemistry 34: 820-822.
6
De Vis R.M., and Van Lenteren C. 2008. Biological control of Trialeurodes vaporariorum by Encarsia formosa on tomato in unheated greenhouse in the high altitude tropics. Bulletin of Insectology 61: 43-57.
7
Dinari A., Dolati L., Nematollahi M.R., Froutan S., and Food C. 2016. The effect of different concentrations of salicylic acid in inducing wheat resistance against Russian wheat aphid. The first electronic conference on new findings in the environment and agricultural ecosystems. Research Institute for New Energy and Environment, University of Tehran, Iran. (In Persian with English abstract)
8
Elhamahmy M.A.M., Mahmoud M.F., and Bayoumi T.Y. 2016. The effect of applying exogenous salicylic acid on aphid infection and its influence on histo-physiological traits and thermal imaging of canola. Cercetări Agronomice în Moldova XLIX: 67-85.
9
El-YazalA.S. 2019. Impact of propolis extract as foliar spray on growth, yield and some chemical composition of spinach (Spinacia oleracea L.) plants grown under calcareous saline soil. International Journal for Empirical Education and Research DOI: 10.35935/edr/32.141
10
Fernandez-Agullo A., Pereira E., Freire M.S., Valentao P., and Andrade P.B., González-Álvarez , and Pereira J.A. 2013. Influence of solvent on the antioxidant and antimicrobial properties of walnut (Juglans regia L.) green husk extracts. Industrial Crops and Products 42: 126-132.
11
Ghahari H., and Hatami B. 2000. Morphological and biological study of greenhouse whitefly. Journal of Agricultural Science and Technology and Natural Resources 4: 141-154.
12
Hancianu, and Aprotosoaie A.C. 2012. The effects of pesticides on plant secondary metabolites. Biotechnological Production of Plant Secondary Metabolites. Pp. 176-186 (11). DOI:10.2174/978160805114411201010176
13
Hayat, Hayat S., Alyemeni M., and Ahmad A. 2012. Salicylic acid mediated changes in growth, photosynthesis, nitrogen metabolism and antioxidant defense system in Cicer arietinum L. Plant Soil and Environment 58: 417-423.
14
Huopalahti R., Lahtinen R., Hiltunen R., and Laakso I. 1988. Studies on the essential oils of dill seed herb, Anethum graveolens Flavour and Fragrance Journal 3: 121- 125.
15
JonesF. 2003. Plant viruses transmitted by whiteflies. European Journal of Plant Pathology 109: 195-219.
16
Kannaiyan S. 2002. Insect pest management strategies: current trends and future prospectus. In: Ignacimuthu S. and S. Jeyaraj (eds) Strategies in integrated pest management. Phoenix Publishing House, New Delhi, India, pp. 1-13.
17
Khani A., and Basavand F. Chemical composition and insecticide activity of essential oil from dill seed seeds. International Journal of Agriculture: Research and Review 3: 489-494.
18
Khanjani M. 2005. Vegetable pests in Iran. Abu Ali Sina University Press, Hamedan, Iran, 467 p. (In Persian with English abstract)
19
Khavari-nejad R., and Asadi A. 2006. The effect of salicylic acid on some of the secondary metabolites (saponins and anthocynins) and induction of antimicrobial resistance in the medicinal plant Bellis perennis Iranian Journal of Medicinal and Aromatic Plants Research 21: 553-586. (In Persian with English abstract)
20
Kogan M., and Paxton J. 1983. Natural inducers of plant resistance to insects. In: Hedin, P.A. (ed) Plant resistance to insects. American Chemical Society, Washington D.C., pp. 153-170.
21
Kumar B.V., Kuttalam S., and Chandrasekaran S. 2009. Efficacy of a new insecticide spirotetramat against cotton whitefly. Pesticide Research Journal 21: 45-48.
22
Lichtenstein, E.P., LiangT., Schulz K.R., and Schnoes H.K. 2002. Insecticidal and synergistic components isolated from dill seed plants. Journal of Agricultural and Food Chemistry 22: 658-64.
23
Mahram G., Kadry H., Thabet C., Olem N., Azizi M., Shiff J., Wong L., and Liv N. 1992. GC/MS analysis of volatile oil of fruits of Anethun graveolens International Journal of Pharmacognoy 30: 139-144.
24
Majnoon Hosseini N. 1989. Cereals in Iran. University Jihad Publications, University of Tabriz, 240 p. (In Persian with English abstract)
25
Mantashloo J., Deljoo A., and Aging S.T. 2017. Evaluation of phenols and flavonoids and antioxidant activity of ethanolic, methanolic, chloroform and ethyl acetate extracts of willow bark and willow branches (Salix alba). Journal of Cellular and Molecular Research 30: 295-303. (In Persian with English abstract)
26
Miliauskas G., Venskutonis P.R., and Van Beek T.A. 2004. Screening of radical scavenging activity of some medicinal plants and aromatic plant extract. Food Chemistry 85: 231-237.
27
Morkunas I., and Gabrys B. 2011. Phytohormonal signaling in plant responses to aphid feeding. Acta Physiologiae Plantarum 33: 2057–2073.
28
Mousavi M. 2014. Insecticidal effect of Tarragon (Artemisia dracunculus) and dill seed (Anethum graveolens L.) essential oils on different biological stages of Trialeurodes vaporariorum Westwood and Aphis gossypii Glover invitro. Master Thesis in Entomology, Faculty of Agriculture, Urmia University, Urmia, Iran. (In Persian with English abstract)
29
Nauen R., Bretschneider T., Elbert A., Fischer R., Reckmann U., and Waetermeulen X.V. 2006. Biological and mechanistic considerations on the mode of action of spirotetramat 11 IUPAC Int. Congress of Pesticide Chemistry, Kobe, Japan. Book of Abstracts (2), II-1-i-21C, 109th.
30
Nauen, Reckmann U., Thomzik J., and Thielert W. 2008. Biological profile of spirotetramat (Movento)—a new two ways systemic (amimobile) insecticide against sucking pests. Bayer Crop Science Journal 61: 245-277.
31
Oliveira I., Sousa A., Ferreira C.F.R., Bento A., Estevinho L., Alberto Pereira J. Total phenols, antioxidant potential and antimicrobial activity of walnut (Juglans regia L.) green husks. Food and Chemical Toxicology 46: 2326–2331.
32
Pappas M.L., Migkou F., and Broufas G. 2013. Incidence of resistance to neonicotinoid insecticides in greenhouse populations of the whitefly, Trialeurodes vaporariorum (Hemiptera: Aleyrodidae) from Greece. Applied Entomology and Zoology 48: 378. DOI: 1007/s13355-013-0197-z
33
Pirasteh-Anosheh H., Emam Y., Ashraf M., and Foolad M.R. 2012. Exogenous application of salicylic acid and chlormequat chloride alleviates negative effects of drought stress in wheat. Advanced Study in Biology 11: 501-520.
34
Pourmorad F., Hosseinimehr S.J., and Shahabimajd N. 2006. Antioxidant activity, phenol and flavonoid contents of some selected Iranian medicinal plants. African Journal of Biotechnology 5: 1142-1145.
35
Rafiei Karhroudi Z., Moharramipour S., Farazmand H., and Karimzadeh Isfahani J. 2010. Repellent and respiratory toxicity of 18 plant essential oils on the Indian Plodia interpunctella Hubner (Lep., Pyralidae). Plant Protection 24: 165-172. (In Persian with English abstract)
36
Rezaei Chianeh A., Valizadegan A., Tajbakhsh M., Dabbagh Mohammadi Nasab A., and Rimaz V. 2014. Study of crop yield and insect diversity in different cultivation patterns of bean and dill seed. Journal of Crops Improvement 16: 353-368. (In Persian with English abstract)
37
Rostami Jiwan N., Hejazi M.J., and Karimzadeh R. 2018. The effect of extracts of five plant species on second instar larvae of potato beetle (Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae). Applied Research in Plant Protection 6: 87-99. (In Persian with English abstract)
38
Sararit P., and Auamcharoen W. 2020. Biological activities of essential oils from Anethum graveolens and Allium sativum L. for controlling Tetranychus truncatus Ehara and Tetranychus urticae Koch. Journal of Biopesticides 13: 1-12.
39
Seddigh S., and Kiani L. 2012. Whitefly Traleurodes vaporariorum (Westwood) control by Encarsia Formosa Gahan and its color preference in commercial Gerbera greenhouse in Iran. Annals of Biological Research 3: 2414-2418.
40
Senaranta T., Teuchela D., Bumm, E., and Dixon K. 2002. Acetyle salycilic acid (aspirin) and salicylic acid induce multiple stress tolerance in bean and tomato plants. Journal of Plant Growth Regulation 30: 157-161.
41
Sharafati-Chaleshtori R., Sharafati-Chaleshtori F., Rafieian-kopaei M., Drees F., and Ashrafi K. 2010. Comparison of the antibacterial effect of ethanolic walnut (Juglans regia) leaf extract with chlorhexidine mouth rinse on Streptococcus mutans and sanguinis. Journal of Islamic Dental Association of Iran (JIDAI) 22: 211-17. (In Persian with English abstract)
42
Shishebor P. 2003. Whitefly (Biology, situation of pest and their management) by Geering Den .1988. Chamran University Press Center, Ahvaz Iran, p. 500-626. (In Persian with English abstract)
43
ORIGINAL_ARTICLE
The Effect of Nutritional Interaction between Micronutrient Fertilizers and Capsicum annuum L. on the Population Growth of Aphidoletes aphidimyza Rondani as Predator of Green Peach Aphid
Introduction: Bell pepper (Capsicum annuum L.) is an important plant of belong to family Solanaceae with the origin of Mexico, which is a rich source of vitamins and beneficial antioxidants to the health and the immune system. The green peach aphid Myzus persicae (Sulzer) (Hemiptera: Aphididae) is one of the severe important pests of bell pepper in the greenhouse, which cause damage in both direct and indirect by feeding on sap and transmitting of viral diseases. The use of insecticides is the most commonly used method for controlling M. persicae, but in addition to the environmental contaminating, it increased the aphid resistance to chemical pesticides. Biological control is one of the alternative methods compatible with the crop ecosystems and is an important component in integrated pest management programs. The aphidophagous midge, Aphidoletes aphidimyza Rondani is an appropriative and important predator of various species aphids including M. persicae. Also, the quality of host plants on the first level of nutrition have important effect on the eco- physiology characteristics of the predator on the third level of nutrition. In this study, the effect of foliar application of micronutrient fertilizers of iron, zinc, copper and manganese on bell pepper was investigated on the biological and demographic parameters of A. aphidimyza fed on M. persicae in greenhouse conditions.
Materials and Methods: The experiments were done as a completely randomized design with 50 replications per treatments during 2020-2021 in the greenhouse. The foliar application of micronutrient was carried out in four-to six-leaf stages with a certain amount of each fertilizer. At the beginning of the experiment, 100 eggs were considered to investigate the study of biology and the life table parameters of A. aphidimyza reared on the M. persicae fed on in each of the experimental treatments. Then daily, these eggs on the all treatments were monitored for recording incubation duration, survival rate and larval developmental duration (50 larvae). A mixture of aphids of different stages were Placed daily on each leaves treatment to feed of A. aphidimyza. Then, the experiments and the observations continued until the emergence of adult insects. After, a pair of male and female adult insects (15 pairs per treatment) were released into each experimental container containing leaves aphid infestation. Daily, the investigate continued for recording of pre-oviposition and oviposition duration, fecundity, male and female longevity until the death of the last individual. Recording of life table parameters and data analysis was performed using the bisexual life table method in TWOSEX-MSChart software. The results were accomplished by Tukey’s post hoc Honestly Significant Difference (HSD) test for showing the mean comparisons (Mean±SE).
Results and Discussion: Based on results, the highest and lowest the intrinsic rate of increase (0.148 and 0.097 / day), the finite rate of population increase (1.160, 1.102 per day) and the net reproduction rate (15.8, and 6.42 offspring/individual) of A. aphidimyza were observed on iron and control treatments, respectively. The results show that there was a significant difference between the different treatments in terms of mean generation time (T) and the highest and the lowest T was obtained on control (19.003 day) and manganese treatment (18.096 day), respectively. Also, the foliar application of micronutrient fertilizers led to reduce the pre-adult time and increase, fecundity, oviposition period and the male and female longevity of A. aphidimyza. The results of this study show that the foliar application of plants with micronutrient fertilizers by improving the growth quality and inducing antibiotic resistance in host plants, has a positive effect on the biology and life table of A. aphidimyza.
Conclusion: The host plants, as the first level of nutrition, have important effects on the predator biology as the third level of nutrition. So, the use of micronutrients by improving the quality of host plants herbivorous insects can be affect the different aspects of the biological characteristics of the higher nutrient level in plant-herbivorous interactions.
Therefore, the foliar application of bell pepper with micronutrient fertilizers along with the use of A. aphidimyza as an appropriative biological control agent for aphids can be effective in integrated management programs of M. persicae.
https://jpp.um.ac.ir/article_40405_b86e7f521b04b9511f57f5dee50f248b.pdf
2022-01-21
481
494
10.22067/jpp.2021.70745.1028
Life table؛ Micronutrient fertilizer
Nutritional interaction؛ Three trophic study
M.
Mirab-balou
majid.mirab@gmail.com
1
Department of Plant Protection, College of Agriculture, Ilam University, Ilam, IRAN
LEAD_AUTHOR
T.
Alizamani
alizamanitaiebeh@yahoo.com
2
Former Ph.D. Student of Entomology, Department of Plant Protection, Faculty of Agriculture, Lorestan University, Lorestan, Iran
AUTHOR
Alizamani T., Razmjou J., Naseri B., Hassanpour M., Asadi A., and Kerr Ch. 2017. Effect of vermicompost on life history of Hippodamia variegata preying on Aphis gossypii Journal of the Entomological Research Society 19(1): 51–60.
1
Alizamani T., Shakarami J., Mardani-Talaee M., Zibaee A., and Serrão J.E. 2020. Direct interaction between micronutrients and bell pepper (Capsicum annum), to affect fitness of Myzus persicae (Sulzer). Journal of Plant Protection Research 60: 253-262.
2
Arshad M., Ullah M.I., Shahid U., Tahir M., Khan M., Rizwan M., Abrar M., and Niaz M.M. 2020. Life table and demographic parameters of the coccinellid predatory species, Hippodamia convergens Guérin-Méneville (Coleoptera: Coccinellidae) when fed on two aphid species. Egyptian Journal of Biological Pest Control 30: 79.
3
Awmack C.S., and Leather S.R. 2002. Host plant quality and fecundity in herbivorous insects. Annual Review of Entomology 47: 817- 844.
4
Bolandandam J., Barker H., and Fenton B. 2004. Differences in potato leaf roll transmitting ability of individual genotypes of Scottish Myzus persicae with different susceptibilities to Lambda- cyhalothrin insecticide. In: Proceedings of 15th International Plant Protection Congress, 11-16 May., Beijing, China, 221 pp.
5
Chen Y., Dawn M., Olson J., and Ruberson R. 2010. Effects of nitrogen fertilization on tritrophic interactions. Arthropod-Plant Interactions 4: 81–94.
6
Chi H. 2018. TWOSEX-MSChart: A Computer Program for the Age-stage, Two Sex Life Table Analysis. Available in: http://140.120.197.173/ Ecology/Download/TWOSEX-MSChart.zip. (Accessed 12 June 2018).
7
Dehghani-Yakhdani H., Iranipour Sh., Mehrnejad M.R., and Farshbaf-Pourabad R. 2019. The role of iron (Fe) in the population dynamics of pistachio psyllid, Agonoscena pistaciae (Hemiptera: Aphalaridae) in Pistacia orchards. European Journal of Entomology 116: 194–200.
8
Du L., Ge F., Zhu S., and Parajulee M.N. 2004. Effect of cotton cultivar on development and reproduction of Aphis gossypii (Homoptera: Aphididae) and its predator Propylaea japonica (Coleoptera: Coccinellidae). Journal of Economic Entomology 97: 1278-1283.
9
Fallahpour F., Ghorbani R., Nassiri Mahallati M., and Hosseini M. 2015. Interaction of different nitrogen fertilization regimes of canola with mustard aphid (Lipaphis erysimi ) and the predatory gall midge (Aphidoletes aphidimyza Rondani). Biological Control of Pests and Plant Diseases 4: 1-12. (In Persian with English abstract)
10
Fallahpour F., Ghorbani R., Nassiri Mahallati M., Hosseini M. 2020. Plant fertilizationhelps plants to compensate for aphid damage, positively affects predator efficiency and improves canola yield. Journal of Pest Science 93: 251-
11
Fenton B., Kasprowicz L., Malloch G., and Pickup J. 2010. Reproductive performance of asexual clones of the peach-potato aphid, Myzus persicae, (Homoptera: Aphididae), colonising Scotland in relation to host plant and field ecology. Bulletin of Entomological Research 100: 451–460.
12
Gagné R.J. The genus Aphidoletes Kieffer (Diptera: Cecidomyiidae) in NorthAmerica. Entomological News 82: 177- 181.
13
Ghafouri Moghaddam M., Golizadeh A., Hassanpour M., Rafiee-Dastjerdi H., and Razmjou J. 2016. Demographic traits of Hippodamia variegata (Goeze) (Coleoptera: Coccinellidae) fed on Sitobion avenae Fabricius (Hemiptera: Aphididae). Journal of Crop Protection 5: 431–445
14
Hansch R., and Mendel, R.R. 2009. Physiological functions of mineral micronutrients (Cu, Zn, Mn, Fe, Ni, Mo, B, Cl). Current opinion in plant Biology 12(3): 259-66.
15
Havelka J., and Zemek R. Life table parameters and oviposition dynamics of various populations of the predacious gall-midge Aphidoletes aphidimyza. Entomologia Experimentalis et Applicata 91: 481-484.
16
Honek A. 1980. Population density of aphid at the time of settling and ovariole maturation in Coccinella septempunctata (Coleoptera: Coccinellidae). Entomophaga 23: 213–216
17
Kalushkov P., and Hodek I. 2004. The effects of thirteen species of aphids on some life history parameters of the ladybird Coccinella septempunctata. Biological Control 50: 223-
18
Khosa S.S., Younis A., Rayit A., Yasmeen S., and Riaz A. 2011. Effect of Foliar Application of Macro and Micro Nutrients on Growth and Flowering of Gerbera jamesonii American-Eurasian Journal of Agricultural and Environmental Sciences 11(5): 736–757.
19
Labafi Y. 1995. Biology of Aphidoletes aphidimyza and methods of laboratory rearing. M.Sc. Thesis, University of Tehran, Karaj, Iran. (In Persian)
20
Lahijie M.F. 2012. Application of micronutrients FeSO4 and ZnSO4 on the growth and development of gladiolus variety “Oscar”. International Journal of Agriculture and Crop Sciences 4: 718- Lahijie M.F. 2012. Application of micronutrients FeSO4 and ZnSO4 on the growth and development of Gladiolus variety “Oscar”. International Journal of Agriculture and Crop Sciences 4(11): 718–720.
21
Liu Z., Li D., Gong, P.Y., and Wu K.J. 2004. Life table studies of the cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae), on different host plants. Environmental Entomology 33: 1570- 1576.
22
Lucas E., and Brodeur J. 2001. A fox in sheep’s clothing: furtive predator benefit from the communal defense of their prey. Ecology 82: 3246- 3250.
23
Madahi K., Sahragard A., and Hosseini R. Influence of Aphis gossypii Glover (Hemiptera: Aphididae) density on life table parameters of Aphidoletes aphidimyza Rondani (Diptera: Cecidomyiidae) under laboratory conditions. Journal of Crop Protection 2: 355- 368.
24
Mansour M.H. The role of plants as a factor affecting oviposition by Aphidoletes aphidimyza (Diptera: Cecidomyiidae). Entomologia Experimentalis et Applicata 18: 173-179.
25
Meadow R.H., Kelly W.C., and Shelton A.M. 1985. Evaluation of Aphidoletes aphidimyza (Dip.: Cecidomyiidae) for control of Myzus persicae (Hom.: Aphididae) in greenhouse and field experiments in the United States. Entomophaga 30: 385-392.
26
Mottaghinia L., Hassanpour M., Razmjou J., Chamani E., and Hosseini M. 2015. The effect of vermicompost on some biological characteristics of the melon aphid Aphis gossypii Glover and the predatory gall midge Aphidoletes aphidimyza Rondani on two cultivars of greenhouse cucumber. Applied research in plant protection 4(2): 56-70.
27
Omkar O., Srivastava S. 2003. Influence of six aphid prey species on development and reproduction of ladybird beetle, Coccinella septempunctata. Biological Control 48: 379–393.
28
Sanatombi K., and Sharma G.J. 2007. Micropropagation of Capsicum annuum using axillary shoot explants. Scientia Horticulturae 113: 96-99.
29
Schmidt M.H., Thewes U., Thies C., and Tscharntke T. 2004. Aphid suppression by natural enemies in mulched cereals. Entomologia Experimentalis et Applicata 113: 87-93.
30
Scholler M., Prozell S.A., Al-Kirshi G., and Reichmuth C. 1997. Towards biological control as a major component of integrated pest management in stored product protection. Journal of Stored Products Research 33: 81-97.
31
Skirvin D.J., and De Courcy W.M. 1999. Differential effects of plant species on a mite pest (Tetranychus urticae) and its predator (Phytoseiulus persimilis): implications for biological control. Experimental and Applied Acarology 23: 497-512.
32
Snyder W.E., Joseph S.B., Preziosi R., and Moore A.J. 2000. Nutritional benefits of cannibalism for the lady beetle Harmonia axyridis (Coleoptera: Coccinellidae) when prey quality is poor. Environmental Entomology 29: 1173–1179
33
Southwood T.R.E. and Henderson P.A. 2000. Ecological methods. Blackwell Science, USA. 575pp.
34
Walker M., Jones T.H. 2001. Relative roles of top-down and bottom-up forces in terrestrial tritrophic plant-insect herbivore-natural enemy systems. Oikos 93: 177-187.
35
Warner L.A., and Croft B.A. 1982. Toxicities of azinphos methyl and selected orchard pesticides to an aphid predator, Aphidoletes aphidimyza. Journal of Economic Entomology 75: 410-415.
36
Yassen A., Abou El-Nour E., and Shedeed S. 2010. Response of wheat to foliar Spray with urea and micronutrients. Journal of American Science 6: 14-22.
37
ORIGINAL_ARTICLE
Effect of Time and Burial Depth on Breaking Seed Dormancy and Percentage of Germination of Myagrum (Myagrum perfoliatum L.) Weed Seeds
Introduction: The internal factors of seeds and the conditions outside the seeds can affect the germination and emergence of seeds. In some cases, environmental conditions are suitable for seed to germinate, while the seeds do no seed dormancy which is regarded to be one of the factors in seed survival. Seeds are exposed to different conditions of temperature fluctuations, moisture fluctuations, activity of microorganisms, etc. by being located at different depths of the soil. For instance, seeds that are located in the surface layers of the soil are more exposed to soil moisture fluctuations, which may also affect their dormancy. The results of various experiments have shown that in addition to the depth of burial of seeds, their burial time also affects their germination. Due to the fact that no experiments have been performed on the germination of myagrum weed seeds in this field, this study was conducted to investigate the effect of time and burial depth on breaking seed dormancy and percentage of germination of myagrum.
Materials and Methods: This study aimed to investigate the effect of burial time and burial depth on breaking seed dormancy and germination of myagrum seeds in factorial experiment based on a randomized complete block design with 4 replications in the research farm of Razi University of Kermanshah in 2014-2015. Experimental factors include burial time (270, 360 and 420 days), burial depth (0, 5, 10, 20 and 40 cm), temperature (25 ° C, 5/10 and 10/20 °C variable temperature) and light (light and dark). In June 2014, myagrum seeds were collected from plants that had become mature and were in the full mature stage stored in plastic nylon at 25 °C until the seeds were tested. At the beginning of the experiment, the seeds were packed in lace bags that had small pores from which the seeds could not exit and then placed at different depths of the farm soil. 340 seeds were placed in each lace bag. The lace bags were such that the seeds were exposed to the moisture, temperature and chemical regimes of the soil. To make it easier to exit the lace bags from the soil, a thread was attached to each bag that was placed on the soil surface. After each level of burial time in the soil (270, 360 and 420 days), lace bags were exited from different depths. Firstly, the number of germinated seeds in each lace bag was counted and the germination percentage was calculated. Germinated seeds were then removed from the bags and the residual of seeds was transferred to the Agriculture Laboratory of the Agricultural and Natural Resources Campus of Razi University. The results of Mondani et al. (16) study showed that myagrum seeds have physiological dormancy and mechanical dormancy due to hard outer shell. Therefore, seeds do not germinate included damaged seeds and seeds had physiological dormancy and mechanical dormancy. Extracted seeds (not germinated seeds) from different depths in each burial time were disinfected in sodium hypochlorite solution (2%) for ten minutes. Then, to ensure the viability of the seeds, a number of seeds of any depth were randomly selected and tested using tetrazolium solution (0.1%). The appearance of red color indicated the existence of respiration and viability of the seeds (13). To remove the mechanical dormancy caused by the hard outer shell in the seeds, the outer shell of the seeds was removed and then the seeds were placed in sterile petri dish with a diameter of 7 cm containing Whatman No. 1 filter paper and 5 ml of distilled water (30 seeds were placed in per petri dish) and to prevent water evaporation, the petri dishes were closed with parafilm. The petri dishes were then exposed to different temperatures (25 °C, 5/10 and 10/20 °C variable temperature) inside the germinator and in light and dark conditions. To exert the effect of darkness, petri dishes were wrapped in an aluminum foil. After 14 days, the number of germinated seeds in each petri dish was counted. Germination criterion was visible root exit. Finally, data analysis was performed by SAS (version 9.4) software and mean comparisons were performed based on Duncan at 5% probability.
Results and Discussion: The results showed the germination percentage of myagrum weed seeds in light and dark were not significantly difference, and also seed burial time, temperature, burial depth and burial time * temperature interaction had a significant effect (p ≤ 0.01) on the germination percentage. The highest germination percentage was observed after 420 days of burial at a variable temperature of 10/20 °C. Also, at the soil surface and with the increasing seed burial depth (more than 5 cm) the survival and seed germination percentage decreased compared to soil depth of 5 cm because seeds need special moisture and temperature conditions for germination. According to the results, these conditions existed at a depth of 5 cm in the soil, so it can be concluded that deep plowing and going -deep seeds may help to manage this weed.
Conclusion: Considering that the highest germination percentage was observed in the temperature regime of 10/20 °C, it can be assumed that this weed can be problematic in summer and autumn crops because this temperature range synchronizes in late winter and early spring. On the other hand, it is possible to control this weed in wheat fields. In fact, in wheat fields, herbicides such as 2,4-D and MCPA are used to control broad-leaf weeds in late March and early April, when the temperature is about 10/20 ° C and the time of germination and emergence of myagrum is used. However, if this weed appears in chickpea fields, it is difficult to control because there is no specific herbicide in chickpea fields to control broadleaf weeds, including myagrum. Also, as the depth of burial increased, the germination percentage of the seeds decreased, so deep plowing and deepening of the seeds may help to manage this weed.
https://jpp.um.ac.ir/article_40389_2291794c5b4fc8535aeaba39e367a501.pdf
2022-01-21
495
504
10.22067/jpp.2021.70381.1023
Germination percentage
plowing
variable temperature
wheat
F.
Sharifi Kalyani
firoozesharifi1371@gmail.com
1
PhD student, Department of Agronomy and Plant Breeding, Faculty of Agriculture, University of Kurdistan, Sanandaj, Iran.
AUTHOR
S.
Jalali Honarmand
sjhonarmand@razi.ac.ir
2
Associate Professor in Department of Agronomy and Plant Breeding, Campus of Agriculture and Natural Resources, University of Razi, Kermanshah, Iran.
LEAD_AUTHOR
I.
Nosratti
irajnosratti@gmail.com
3
Associate Professor in Department of Agronomy and Plant Breeding, Campus of Agriculture and Natural Resources, University of Razi, Kermanshah, Iran.
AUTHOR
alireza
bagheri
alireza884@yahoo.com
4
دانشگاه رازی کرمانشاه
AUTHOR
H.
Heidari
heidari1383@gmail.com
5
Assistant Professor in Department of Agronomy and Plant Breeding, Campus of Agriculture and Natural Resources, University of Razi, Kermanshah, Iran.
AUTHOR
Baskin C.C., and Baskin J.M. 1998. Seeds: ecology, biogeography, and, evolution of dormancy and germination. Elsevier.
1
Benvenuti S., Macchia M., and Miele S. 2001. Light, temperature and burial depth effects on Rumex obtusifolius seed germination and emergence. Weed Research 41(2): 177-186.
2
Biswas P.K., Bell P.D., Crayton J.L., and Paul K.B. 1975. Germination behavior of Florida pusley seeds. I. Effects of storage, light, temperature and planting depths on germination. Weed Science 400-403.
3
Cardina J., Herms C.P., and Doohan D.J. 2002. Crop rotation and tillage system effects on weed seed banks. Weed Science 50(4): 448-460.
4
Chauhan B.S., and Johnson D.E. 2008. Seed germination and seedling emergence of giant sensitiveplant (Mimosa invisa). Weed Science 244-248.
5
Conn J.S. 2006. Weed seed bank affected by tillage intensity for barley in Alaska. Soil and Tillage Research 90(1-2): 156-161.
6
Cristaudo A., Gresta F., Luciani F., and Restuccia A. 2007. Effects of after‐harvest period and environmental factors on seed dormancy of Amaranthus species. Weed Research 47(4): 327-334.
7
Ebrahimi E., and Eslami S. 2010. Seed germination and seedling emergence of dodder (Cuscuta monogyna) (Iran). In: Proceedings of the 3th Iranian weed science Congress. Babolsar. pp. 52-56. (In Persian with English abstract)
8
Evans S.P., Knezevic S.Z., Lindquist J.L., Shapiro C.A., and Blankenship E.E. 2003. Nitrogen application influences the critical period for weed control in corn. Weed Science 51(3): 408-417.
9
Faccini D., and Vitta J.I. 2005. Germination characteristics of Amaranthus quitensis as affected by seed production date and duration of burial. Weed Research 45(5): 371-378.
10
Ghaderi-Far F., Gherekhloo J., and Alimagham M. 2010. Influence of environmental factors on seed germination and seedling emergence of yellow sweet clover (Melilotus officinalis). Planta Daninha 28(3): 463-469.
11
Haghighi-Khah M., Khajeh-Hosseini M., and Bannayan-Awal M. 2013. Effect of different treatments on breaking dormancy of various species of Barnyard grass (Echinochloa crus galli and Echinochloa awal orizy cola). Journal of Plant Protection 27(2): 255-257. (In Persian with English abstract)
12
Kamkar B., Soltani A., and Akram Ghaderi F. 2014. Seed Science and Technology. Publications University of Mashhad, Iran. 512 pp.
13
Koller D., and Kozlowski T.T. 1972. Environmental control of seed germination. Seed Biology 2.
14
Milberg P., Andersson L., and Thompson K. 2000. Large-seeded spices are less dependent on light for germination than small-seeded ones. Seed Science Research 10(1): 99-104.
15
Mondani F., Jalilian A., and Olfati A. 2018. Evaluation of the chemical and physical treatments on seed germination characteristics of Myagrum (Myagrum perfoliatum). Iranian Journal of Seed Science and Research 5(1): 55-68. (In Persian with English abstract)
16
Muskweed policy. 2004. Declared Plant Policy under the Natural Resources Management Act, muskweed (Myagrum perfoliatum). Government of South Australia.
17
Nazari Kh. 2016. Study of germination and emergence of Myagrum perfoliatum L. Sc. Dissertation, University of Razi, Iran. (In Persian with English abstract)
18
Nishimoto R.K., and McCarty L.B. 1997. Fluctuating temperature and light influence seed germination of goosegrass (Eleusine indica).Weed Science 426-429.
19
Ohadi S., Mashhadi H.R., and Tavakol-Afshari R. 2009. Seasonal changes in germination responses of seeds of the winter annual weed littleseed canarygrass (Phalaris minor) to light. Weed Science 57(6): 613-619.
20
Payamani R., Nosratti I., and Amerian M. 2020. The effect of thermal shock, burial depth and seed position on germination of seeds of heteromorphism hedge parsley (Torilis arvenis). International Journal of Plant Production 43(1): 1-12. (In Persian with English abstract)
21
Pollard F., and Cussans G.W. 1976. Influence of tillage on the weed flora of four sites sown to successive crops of spring barley. In Proceedings.
22
Roger-Estrade J., Colbach N., Leterme P., Richard G., and Caneill J. 2001. Modelling vertical and lateral weed seed movements during mouldboard ploughing with a skim-coulter. Soil and Tillage Research 63(1-2): 35-49.
23
Singh H.P., Batish D.R., Setia N., and Kohli R.K. 2005. Herbicidal activity of volatile oils from Eucalyptus citriodora against Parthenium hysterophorus. Annals of Applied Biology 146(1): 89-94.
24
Singh M., and Achhireddy N.R. 1984. Germination ecology of milkweedvine (Morrenia odorata) Weed Science 781-785.
25
Tang D.S., Hamayun M., Ko Y.M., Zhang Y.P., Kang S.M., and Lee I.J. 2008. Role of Red Light, Temperature, Stratification and Nitrogen in Breaking Seed Dormancy of Chenopodium album Journal of Crop Science and Biotechnology 11(3): 199-204.
26
Tela-Botanica. 2011. Digitization project of the flora of Abbot. Costa by Tela-Botanica Network.
27
2016. http:// plants. usda. gov/ core/ profile? symbol= MYPE.
28
ORIGINAL_ARTICLE
Intra-specific Variations among Different Canada Thistle (Cirsium arvense L.) Ecotypes
Introduction: Canada thistle (Cirsium arvense L.( occurs in pastures and wheat fields and is common in most provinces, where it is considered a major agricultural weed in Iran. Increasing our understanding of the environmental factors that determine Canada thistle emergence can provide strategies to control it. Therefore, in this paper the morphological characteristics of 10 ecotypes collected from different regions of Iran and the effect of temperature on the percentage and rate of emergence of root buds in controlled conditions were investigated. Temperature was considered as the treatment because it is one of the most important factors that fluctuate between the diffusion regions in Iran.
Materials and Methods: To evaluate any morphological differences among ecotypes of Canada thistle, root fragments were collected from 10 provinces of Iran in 2020. To reduce the effect of the environment, the roots were propagated again in pots in the greenhouse under controlled conditions. Day and night temperatures were 30 and 15 °C, respectively. The root pieces were then harvested and stored at 5 °C for 3 months. Two 10 cm long roots with same weight and same number of buds were planted in pots containing loamy sandy soil. The pots were irrigated during the experiment and the plants were not exposed to water stress. A Completely Randomized Design was conducted at Science Research Branch, Islamic Azad University. After 70 days plants were harvested. The numbers of leaves and branches on the main shoot and number of capitulum were counted and the root length, height of the main shoot and capitulum length were measured. Data analysis of variance was performed using SAS software and means were compared using protected LSD test. Cluster analysis was performed by calculating the Euclidean distance for grouping populations using SPSS software and its dendrogram was drawn. The root and shoot dry weights were measured after drying at 70 °C for 48 h after harvest. At second experiment, temperatures 1- 38° C were evaluated for studying the effect of temperature on percent and rate of shoot emergence. Base temperature (temperature at which the germination rate is zero) was obtained using the linear regression equation between germination rate and temperature.
Results: There were significant differences at morphological traits among Canada thistle ecotypes except capitulum length. Root dry weight varied from 8 g in Gonbad ecotype to 11.5 g in Varamin ecotype. Total dry weight was the lowest in Hamedan and was not significantly different from Mashhad and Gonbad ecotypes. The highest total dry weight belonged to Shiraz ecotype. Cluster analysis grouped 10 ecotypes at four groups. First group consisted of Babol, Gonbad and Moghan ecotypes. Varamin, Shahreza, Mashhad, Hamedan and Shiraz placed at second group. Kermanshah and Dezful were placed at third and fourth groups, respectively. In the next step, the data were correlated into principal components on the correlation matrix. In total, the three main components explained about 80.20% of the total data changes. The first component explained 34.33% of the changes. Main stem height, total dry weight and number of leaves had a positive correlation with this component and shoot dry weight had a negative correlation with it. The second component explained 33.82% of the changes in the total data. Groundwater dry weight and total stem + root length had high coefficients in this component. The third component accounted for 12.03% of the changes, with only the number of capitols in each branch having a high positive correlation with this component. The estimated base temperatures for the emergence of bud root were 5.34, 4.91, 5.98, 5.70, 4.42, 6.52, 3.12, 6.26, 3.80 and 5.91°C for Babol, Varamin, Shahreza, Gonbad, Mashhad, Dezful, Kermanshah, Moghan, Hamedan and Shiraz ecotypes, respectively. Emergence growth degree day for Babol, Varamin, Shahreza, Gonbad, Mashhad, Dezful, Kermanshah, Moghan, Hamedan and Shiraz were 201, 210, 200, 205, 190, 220, 182, 202, 190 and 210, respectively.
Conclusion: Temperature had a significant influence on the root of Canada thistle. When the temperature was below 3°C, no emergence occurred. Temperature affected not only the percentage of emergence but also the emergence rate. There was a significant linear relationship between the emergence rate and incubation temperature. High temperature probably causes activation of the enzymatic and physiological function of root buds and increases the rate of mobilization of nutrient reserves to the growing belowground shoots.
https://jpp.um.ac.ir/article_40720_3d851137f3eb1a4e6238f9b352f7b3e0.pdf
2022-01-21
505
517
10.22067/jpp.2021.72064.1046
Capitule number emergence temperature base
Emergence rate
Growing degree day
Shoot dry weight
M.
Diayanat
ma_dyanat@yahoo.com
1
Department of Agricultural Sciences and Food Industries, Science and Research Branch, Islamic Azad University, Tehran, Iran
LEAD_AUTHOR
Bodo Slotta T.A., Foley M., Chao S.H., Hufbaue R.A., and Horvath D.P. 2010. Assessing genetic diversity of Canada thistle (Cirsium arvense) in North America with microsatellites. Weed Science 58: 387-394.
1
Bodo Slotta T.A., Horvath D.P., and Foley M.E. 2006. Relationships of weedy and native thistles (Cirsium) in the Northern Great Plains. – Weed Science Society of America.
2
Bodo Slotta T.A., and Horvath D.P. 2005. Development of poly-morphic markers for Cirsium arvense, Canada thistle, and their amplification in closely related taxa. Molecular Ecology Notes 5: 917-919.
3
Cardina J., and Brecke B.J. 1989. Growth and development of Florida beggarweed (Desmodium tortuosum) selections. Weed Science 37: 207–210.
4
Donald W.W. 2000. A degree-day model of Cirsium arvense shoot emergence from adventitious root buds in spring. Weed Science 48: 333-341.
5
Ghersa C.M., Satorre E.H., Van ESSO M.L., Pataro A., and Elizagaray, R. 1990. The use of thermal calendar models to improve the efficiency of herbicide applications in Sorghum halepense (L.) Pers. Weed Research 30: 153–60.
6
Goodwin M.S., Morrison I.N., and Thomas A.G. 1986. A weed survey of pedigreed alfalfa seed fields in Manitoba. Canadian Journal of Plant Science 66: 413–416.
7
Hakansson S. 2003. Weeds and weed management in arable land: An ecological approach. CABI Publishing, Wallingford, UK. 274 pp.
8
Hodgson J.M. 1968a. The nature, ecology and control of Canada thistle. U.S. Dep. Agric. Tech. Bull. 1386. 32 pp.
9
Hodgson J.M. 1968b. Canada thistle and its control. U.S. Dep. Agric. Leaf. No. 523. 8 pp.
10
Holshouser D.L., Chandler J.M., and Wu H.I. 1996. Temperature-dependent model for non-dormant seed germination and rhizome bud break of Johnsongrass (Sorghum halepense). Weed Science 44: 257–265.
11
Holt J.S., and Orcutt D.R. 1996. Temperature thresholds for bud sprouting in perennial weeds and seed germination in cotton. Weed Science 44: 523–533.
12
Hossain A.M., Akamine H., Nakamura Yukioishimine I., and Kuramochi H. 2001. Influence of temperature levels and planting time on the sprouting of rhizome-bud and biomass production of torpedo grass (Panicum repens) in Okinawa Island, southern Japan. Weed Biology and Management 1: 164–169.
13
Huang W.Z., Hsiao A.I., and Jordan L. 1987. Effects of temperature, light and certain growth regulating substances on sprouting, rooting and growth of single-node rhizome and shoot segments of Paspalum distichum Weed Research 27: 57-67.
14
Hubner R., Fykse H., Hurle K., and Klemsdal S.S. 2003. Morphological differences, molecular characterization, and herbicide sensitivity of catchweed bedstraw (Galium aparine) population. Weed Science 51: 214-225.
15
Hunter J.H., and Smith L.W. 1972. Environment and herbicide effects on Canada thistle ecotypes. Weed Science 20: 163-167.
16
Hutman H., Kester D., and Davis F. 1990. Plant propagation, principle and practices, Prentice Hall Imitational Edition. 647 p.
17
Kawabata O., and Nishimoto R.K. 2003.Temperature and rhizome chain effect on sprouting of purple nutsedge (Cyperus rotundus) ecotypes. Weed Science 51: 348–355.
18
Klingaman T.E., and Oliver L.R. 1996. Existence of ecotypes among populations of entireleaf morningglory (Ipomoea hederacea integriuscula). Weed Science 44: 540–544.
19
Krueger-Mangold J., Sheley R.L., and Roos B.D. 2002. Maintaining plant community diversity in a waterfowl production area by controlling Canada thistle (Cirsium arvense) using glyphosate. Weed Technology 16: 457-463.
20
Kurokawa S., Shimizu N., Uozumi S., and Yoshimura Y. 2003. Intraspecific variation in morphological characteristics and growth habit of newly and accidentally introduced velvetleaf (Abutilon theophrasti) into Japan. Weed Biology and Management 3: 28–36.
21
Li B., Shibuya T., Yogo Y., and Hara T. 2000. Effects of temperature on bud-sprouting and early growth of Cyperus esculentus in the dark. Journal of Plant Research 113:19–27.
22
Link A.J., and Kommedahl T. 1958. Canada thistle - spotlight on a troublesome weed. Minnesota Farm and Home Science 15: 2l-22.
23
Lym R.G., and Duncan C. 2005. Canada thistle (Cirsium arvense (L.) Scop. pp 69-83. In C.A. Duncan, and J.K. Clark (eds.) Invasive Plants of Range and Wild lands and their Environmental, Economic and Societal Impacts. Weed Science Society of America, Allen Press.
24
Maxwell B.D., Lehnhoff E.A., and Rew L.J. 2009. The rationale for monitoring invasive plant populations as a crucial step for management. Invasive Plant Science Managment 2: 1-9.
25
Moore R.J. 1975. The biology of Canadian weeds. 13. Cirsium arvense (L.) Scop. Canadian Journal of Plant Science 55: 1033-1048.
26
Morishita D.W. 1999. Canada thistle. Pages 162–174. In R.L. Sheley and J.K. Petroff, (eds.). Biology and Management of Noxious Rangeland Weeds. Corvallis, OR: Oregon State University.
27
Nadeau L.B., and Vanden Born W.H. 1989. The root system of Canada thistle. Canadian Journal of Plant Science 69: 1199–1206.
28
Nezamabadi N., Rahimian mashhadi H., Zand E., and Alizadeh H.M. 2006. Investigation of some ecophysiological aspects of Iicorice Glycyrrhiza glabra. Pest and Diseases Plant 74: 45-61.
29
Nilsen E.T., and Orcutt D.M. 1996. Physiology of Plants under Stress: Abiotic Factors. John Wiley and Sons, New York.
30
Norris R.F. 1996. Morphological and phenological variation in barnyard grass (Echinochloa crus-galli) in California. Weed Science 44: 804–814.
31
Ransom C.V., Kelis J.J., Was, L.M., and Orfanedes M.S. 1998. Morphological variation among hemp dogbane (Apocynum cannabinum) populations. Weed Science 46: 71-75.
32
Rechynger K.H. 1979. Cirsium Pages 231–280. In K.H. Rech´ynger, (ed.). Flora Iranica, Tomus 139a. Compositae III—Cynareae. Graz, Austria: Akademishe Druck-und-Verlansanstalt.
33
Riesinger P., and Hyvönen T. 2006. Impact of management on weed species composition in organically cropped spring cereals. Biological Agricultural Horticulture 24: 257–274.
34
Rew L.J., Lehnhoff E.A., and Maxwell B.D. 2007. Nonindigenous species management using a population prioritization framework. Canadian Journal of Plant Science 87: 1029-
35
Saidak W.J., and Marriage P.B. 1976. Response of Canada thistle varieties to amitrole and glyphosate. Canadian Journal of Plant Science 56: 211-214.
36
Salonen J., Hyvönen T., and Jalli H. 2001. Weed flora in organically grown spring cereals in Finland. Agricultural and Food Science in Finland 10: 231–242.
37
Satorre E.H., Ghersa C.M.G., and Pataro A.M. 1985. Prediction of Sorghum halepense (L.) Pers. rhizome sprout emergence in relation to air temperature. Weed Research 25: 103-109.
38
Satorre E.H., Rirro F.A., and Arias S.P. 1996. The effect of temperature on sprouting and early establishment of Cynodon dactylon. Weed Research 36: 431-440
39
Seif E., Sheidai M., Norouzi M., and Noormohammadi Z. 2012. Biosystematic studies of Cirsium arvense populations in Iran. Phytologia Balcanica 18: 305–314.
40
Skinner K., Smith L., and Rice P. 2000. Using noxious weed lists to prioritize targets for developing weed management strategies. Weed Science 48: 640–644.
41
Sole M., Durka W., Eber S., and Brandl R. 2004. Genotypic and genetic diversity of the common weed Cirsium arvense (Asteraceae). International Journal of Plant Science 165: 437–444.
42
Spencer D.F., and Ksander G.G. 2006. Estimating Arundo donax ramet recruitment using degree-day based equations. Aquatic Botany 85: 282–288.
43
Thomas A.G., Frick, B.L., and Hall L.M. 1998. Alberta Weed Survey of Cereal and Oilseed Crops in 1997. Saskatoon, SK, Canada: Agriculture Canada, Weed Survey Series Publ. 98-2. 283 p.
44
Tiley G.E.D. 2010. Biological flora of the British Isles: Cirsium arvense (L.) Scop. Journal of Ecology 98: 938–983.
45
Townsend C.R., Begon M., and Harper J.L. 2003. Essentials of ecology, 2nd edn. Blackwell Publishing Ltd., Malden, USA.
46
Travlos I.S., Economou G., Kotoulas V.E., Kanatas P.J., Kontogeorgos A.N., and Karamanos A. 2009. Potential effects of diurnally alternating temperatures and solarization on purple nutsedge (Cyperus rotundus) tuber sprouting. Journal of Arid Environment 73: 22–25.
47
Van Driesche R.G., Blossey B., Hoddle M., Lyon S., and Reardon R. 2002. Biological Control of Invasive Plants in the Eastern United States. Morgantown, WV: USDA Forest Service, FHTET-2002-04.
48
Wassom J.J., Tranel P.J., Wax L.M. 2002. Variation among U.S. accessions of common cocklebur (Xanthium strumarium). Weed Technology 16: 171–179.
49
White D.E. 1979. Physiological Adaptations in Two Ecotypes of Canada Thistle, Cirsium arvense (L.) M.S. Thesis, Univ. California, Davis, CA. 69 p.
50
Zouhar K. 2001. Cirsium arvense. – In: Fire Effects Information System. U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory (Producer). http://www.fs.fed.us/database/feis/ (accessed February 2012).
51